ID: 1077887655

View in Genome Browser
Species Human (GRCh38)
Location 11:6397641-6397663
Sequence AGCCATGCCTGCTGCAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 1, 3: 52, 4: 390}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077887652_1077887655 -2 Left 1077887652 11:6397620-6397642 CCAACTAGGTGCTGTCTAGGAAG 0: 1
1: 0
2: 0
3: 15
4: 101
Right 1077887655 11:6397641-6397663 AGCCATGCCTGCTGCAGGGCAGG 0: 1
1: 0
2: 1
3: 52
4: 390
1077887650_1077887655 9 Left 1077887650 11:6397609-6397631 CCTTCAGGGCTCCAACTAGGTGC 0: 1
1: 0
2: 1
3: 2
4: 73
Right 1077887655 11:6397641-6397663 AGCCATGCCTGCTGCAGGGCAGG 0: 1
1: 0
2: 1
3: 52
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077887655 Original CRISPR AGCCATGCCTGCTGCAGGGC AGG Intronic