ID: 1077887658

View in Genome Browser
Species Human (GRCh38)
Location 11:6397647-6397669
Sequence GCCTGCTGCAGGGCAGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1083
Summary {0: 1, 1: 1, 2: 8, 3: 134, 4: 939}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077887652_1077887658 4 Left 1077887652 11:6397620-6397642 CCAACTAGGTGCTGTCTAGGAAG 0: 1
1: 0
2: 0
3: 15
4: 101
Right 1077887658 11:6397647-6397669 GCCTGCTGCAGGGCAGGGAGAGG 0: 1
1: 1
2: 8
3: 134
4: 939
1077887650_1077887658 15 Left 1077887650 11:6397609-6397631 CCTTCAGGGCTCCAACTAGGTGC 0: 1
1: 0
2: 1
3: 2
4: 73
Right 1077887658 11:6397647-6397669 GCCTGCTGCAGGGCAGGGAGAGG 0: 1
1: 1
2: 8
3: 134
4: 939

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077887658 Original CRISPR GCCTGCTGCAGGGCAGGGAG AGG Intronic