ID: 1077887875

View in Genome Browser
Species Human (GRCh38)
Location 11:6399473-6399495
Sequence CCACATCGAACCAATCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077887869_1077887875 9 Left 1077887869 11:6399441-6399463 CCAGGAACTTAGGAGTCATCCTT 0: 1
1: 1
2: 11
3: 67
4: 368
Right 1077887875 11:6399473-6399495 CCACATCGAACCAATCACTGAGG 0: 1
1: 0
2: 1
3: 11
4: 84
1077887868_1077887875 16 Left 1077887868 11:6399434-6399456 CCAACAGCCAGGAACTTAGGAGT 0: 1
1: 0
2: 1
3: 18
4: 129
Right 1077887875 11:6399473-6399495 CCACATCGAACCAATCACTGAGG 0: 1
1: 0
2: 1
3: 11
4: 84
1077887870_1077887875 -10 Left 1077887870 11:6399460-6399482 CCTTGTCCCTCACCCACATCGAA 0: 1
1: 0
2: 1
3: 17
4: 169
Right 1077887875 11:6399473-6399495 CCACATCGAACCAATCACTGAGG 0: 1
1: 0
2: 1
3: 11
4: 84
1077887866_1077887875 25 Left 1077887866 11:6399425-6399447 CCAGAAGGTCCAACAGCCAGGAA 0: 1
1: 0
2: 2
3: 22
4: 245
Right 1077887875 11:6399473-6399495 CCACATCGAACCAATCACTGAGG 0: 1
1: 0
2: 1
3: 11
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077887875 Original CRISPR CCACATCGAACCAATCACTG AGG Intronic
902569144 1:17335819-17335841 TCACATCGAACCTCTCATTGTGG + Intronic
910221563 1:84893525-84893547 CCACTTCAAACAAATCTCTGAGG - Intergenic
910439091 1:87233833-87233855 TCACATAGTACCAAGCACTGAGG - Intergenic
910564758 1:88631050-88631072 CCACATCCAATCAATTACTAAGG - Intergenic
915316287 1:155030764-155030786 CCACCTTGACCCAAGCACTGGGG - Intronic
919669243 1:200323878-200323900 CAACCTTGATCCAATCACTGTGG + Intergenic
921115619 1:212088087-212088109 TCCCATTGAATCAATCACTGGGG - Intronic
924589027 1:245385890-245385912 CCACATCCAACCAATCTCCAAGG - Intronic
1068499799 10:57830121-57830143 CCACATCAAATTAATCACTTTGG - Intergenic
1069718913 10:70537967-70537989 CCACAGCAAGCCAGTCACTGCGG - Intronic
1077887875 11:6399473-6399495 CCACATCGAACCAATCACTGAGG + Intronic
1081377230 11:42374237-42374259 CCACATAGAAGGAACCACTGTGG - Intergenic
1083685547 11:64373055-64373077 CCACACTGAACCAATCACTGTGG + Intergenic
1089651398 11:119916123-119916145 CCAAAATGAACCAATCACGGGGG - Intergenic
1094066566 12:26367459-26367481 TCACATCCACCAAATCACTGAGG + Intronic
1096964383 12:55613645-55613667 CCACATGGCAACAATCACTGAGG - Intergenic
1098160046 12:67641194-67641216 TCACATTGAACTAAGCACTGTGG - Intergenic
1100176128 12:92033017-92033039 CCATCTCTGACCAATCACTGTGG + Intronic
1100382325 12:94073430-94073452 CCACAGCCAACCCATCACTAGGG + Intergenic
1103139928 12:118539765-118539787 CATCCTTGAACCAATCACTGAGG + Intergenic
1103227840 12:119303454-119303476 CCAGAGGGAACCAATCACTGTGG + Intergenic
1104177271 12:126345083-126345105 CATCCTCGGACCAATCACTGTGG + Intergenic
1104647414 12:130507000-130507022 CAACCCTGAACCAATCACTGAGG - Intronic
1111203548 13:84972876-84972898 GCACAGAGAGCCAATCACTGAGG + Intergenic
1118292703 14:64540757-64540779 CCACCTCGAACCAAGCACCACGG - Intronic
1120073368 14:80127677-80127699 CATCATTGAACCAGTCACTGTGG - Intergenic
1120732253 14:88016933-88016955 CACCACTGAACCAATCACTGTGG - Intergenic
1123940285 15:25213372-25213394 CCACATAGAACCCATTACAGGGG + Intergenic
1126237498 15:46402791-46402813 TTACATCTAACCAATCACTATGG - Intergenic
1128684738 15:69675399-69675421 GCCCACTGAACCAATCACTGTGG - Intergenic
1134874599 16:17686379-17686401 CAACTCCGCACCAATCACTGTGG - Intergenic
1135886499 16:26313974-26313996 GCAGATCGCACCAATGACTGTGG + Intergenic
1135947191 16:26875488-26875510 CCACAGAAAGCCAATCACTGGGG + Intergenic
1137699710 16:50488831-50488853 CCACACTGGACCAATCACTGTGG + Intergenic
1138630998 16:58293994-58294016 CCACACAGAACCAAGCACTAGGG - Exonic
1142527207 17:551953-551975 GCAAATCAAACAAATCACTGTGG + Intronic
1149261065 17:54879922-54879944 CCAAATCCAACCAATCACAATGG + Intergenic
1151777457 17:76215785-76215807 CCAGATCAAAGCAATCACTGAGG + Intronic
1152059798 17:78063525-78063547 CCACAAGGGACCAATCCCTGAGG + Intronic
1152232641 17:79122007-79122029 CCCCATCAAACCCATCTCTGAGG + Intronic
1152641729 17:81452169-81452191 CCACATCGGCCCCAGCACTGTGG - Intronic
1157939760 18:51915227-51915249 CCAAATAGAACCAATAAATGAGG + Intergenic
1159917928 18:74202695-74202717 CCTCATCTTACCAATCACTGGGG - Intergenic
1161647241 19:5460986-5461008 CCATCCTGAACCAATCACTGTGG - Intergenic
1163228745 19:15983456-15983478 CCACATGGAACAAATGTCTGGGG - Intergenic
1163572965 19:18093652-18093674 ACACCTTGAACCAATCACAGTGG + Intronic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
1167868890 19:52351040-52351062 TTACAACGAAACAATCACTGAGG - Intronic
1168355917 19:55699694-55699716 CCACATACAAGCAATCACCGGGG - Intronic
930550322 2:52826519-52826541 CCACATTTAACCAATTACTCAGG - Intergenic
931652872 2:64484243-64484265 CCATCTTGGACCAATCACTGTGG - Intergenic
938381603 2:130839297-130839319 CCTCATAGGACCAATCCCTGGGG - Intronic
941405226 2:165078858-165078880 CCATATTGAACCAATCTCTGTGG + Intergenic
943346695 2:186746701-186746723 CATCATTGAACAAATCACTGTGG + Intronic
945951123 2:216039884-216039906 CCATTTCCAACCAATAACTGTGG - Intronic
1169839066 20:9914290-9914312 CCACTTCAAACCAACTACTGTGG + Intergenic
1172790017 20:37496773-37496795 CCACATTGAGCCCATTACTGTGG + Intronic
1173259608 20:41422038-41422060 CTACGTTGAACCCATCACTGAGG - Exonic
1178056326 21:28803015-28803037 CAGCATTAAACCAATCACTGGGG + Intergenic
1178253157 21:31023963-31023985 CCACTTCTAACCAATCCCTTCGG - Intergenic
1179554699 21:42164698-42164720 CAACATCGAACCAAGATCTGGGG - Intergenic
1180568808 22:16697396-16697418 CCACATGGCACAAGTCACTGTGG - Intergenic
1181744683 22:24947814-24947836 CTACCACGAATCAATCACTGTGG + Intergenic
950190986 3:10976030-10976052 CCTCCCTGAACCAATCACTGTGG + Intergenic
950564843 3:13762524-13762546 AATCCTCGAACCAATCACTGTGG - Intergenic
951548622 3:23854279-23854301 CCTCTCTGAACCAATCACTGTGG - Intronic
954457697 3:50608781-50608803 CCACATGGAAACAATCAAGGTGG - Intronic
956785520 3:72638937-72638959 CCACATTGGCCCAAGCACTGGGG + Intergenic
960145070 3:114192128-114192150 GCACCTCTAACCAATCACAGAGG - Intronic
961445221 3:126977357-126977379 CCCCCTTGAACCCATCACTGTGG - Intergenic
961671648 3:128536433-128536455 CACCAACGATCCAATCACTGAGG - Intergenic
962011718 3:131398048-131398070 CCACCCTGAACCAATCCCTGTGG + Intergenic
963106127 3:141648729-141648751 CCACATCAAACCAACCACAGAGG + Intergenic
966865600 3:184257633-184257655 CCACATCAAAAGAAGCACTGGGG - Exonic
970576211 4:17430726-17430748 CAACTTGGAACCAATCATTGTGG - Intergenic
970916050 4:21336607-21336629 CCACACAGAACCAAGCACAGAGG - Intronic
975877153 4:78854670-78854692 CCTAATCGAACCAGTCACAGTGG - Intronic
979293206 4:119000913-119000935 CCACCTGAAACCATTCACTGGGG + Intronic
998804428 5:145904636-145904658 CAACCCCGAACCAATCACTGTGG - Intergenic
1002885589 6:1290752-1290774 CCACATTGACCAACTCACTGGGG + Intergenic
1004582263 6:16965633-16965655 CCACAACGCACCAAACGCTGGGG - Intergenic
1006071847 6:31503995-31504017 CCACTTCAAACCAATCAGGGTGG - Intronic
1028231496 7:88311136-88311158 CATCATTGGACCAATCACTGTGG - Intergenic
1028892233 7:96001300-96001322 CCACCTCCAGCCATTCACTGAGG + Intronic
1040872308 8:52113354-52113376 ACACATTGACCCAATCACAGTGG + Intronic
1048981883 8:139706753-139706775 CCAAATCCAGCCAATCACCGTGG - Intergenic
1052812449 9:33073550-33073572 CCACAACGAACCAACCCATGGGG + Intronic
1055904821 9:81280772-81280794 CATCACTGAACCAATCACTGTGG - Intergenic
1056027862 9:82519094-82519116 ACACATCCAACCAGTCTCTGAGG - Intergenic
1057522272 9:95769490-95769512 CCACCATGAACCAATCACTGAGG - Intergenic
1057522303 9:95769703-95769725 CCACCATGAACCAATCACTGAGG - Intergenic
1188538274 X:31221024-31221046 CCACATCAAATGAATCACTGAGG + Intronic
1189204339 X:39225035-39225057 CCTCTCTGAACCAATCACTGAGG + Intergenic
1190010631 X:46781471-46781493 CAACTCTGAACCAATCACTGTGG + Intergenic
1190224937 X:48538082-48538104 CAACTACGAACCAATCAATGGGG - Intergenic
1199756434 X:150869335-150869357 CCACATCCGACCCATCAATGAGG + Intronic
1201723480 Y:17129889-17129911 ACACAGAAAACCAATCACTGAGG - Intergenic