ID: 1077889641

View in Genome Browser
Species Human (GRCh38)
Location 11:6409928-6409950
Sequence CTGTATCCTTGCAATGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077889637_1077889641 28 Left 1077889637 11:6409877-6409899 CCAAAGGGTTTTCTTTTCTAACT 0: 1
1: 0
2: 2
3: 51
4: 595
Right 1077889641 11:6409928-6409950 CTGTATCCTTGCAATGGTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 121
1077889636_1077889641 29 Left 1077889636 11:6409876-6409898 CCCAAAGGGTTTTCTTTTCTAAC 0: 1
1: 0
2: 7
3: 162
4: 514
Right 1077889641 11:6409928-6409950 CTGTATCCTTGCAATGGTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 121
1077889638_1077889641 -7 Left 1077889638 11:6409912-6409934 CCTACTCCTGACAAAACTGTATC 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1077889641 11:6409928-6409950 CTGTATCCTTGCAATGGTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077889641 Original CRISPR CTGTATCCTTGCAATGGTGC TGG Intronic
900685672 1:3946187-3946209 AAGTATCCATGCAAGGGTGCGGG - Intergenic
901310711 1:8267503-8267525 CTGGATGCTGGCAATGGTGATGG + Intergenic
901347738 1:8561645-8561667 CTGTATCTGTGCAATGGCACTGG + Intronic
906571064 1:46840996-46841018 CTGTATCCATTAAATTGTGCTGG - Intergenic
906600211 1:47120308-47120330 CTGTATCCATTAAATTGTGCTGG + Intergenic
913681337 1:121188628-121188650 AGGTCTCCTTGCACTGGTGCAGG - Intronic
914033168 1:143976269-143976291 AGGTCTCCTTGCACTGGTGCAGG - Intergenic
914156278 1:145091697-145091719 AGGTCTCCTTGCACTGGTGCAGG + Intronic
914578855 1:149001881-149001903 GTTTATTCTTTCAATGGTGCTGG - Exonic
919458754 1:197851360-197851382 CTTTATCTGTGAAATGGTGCTGG - Intergenic
920468653 1:206207154-206207176 AGGTCTCCTTGCACTGGTGCAGG - Intronic
922875505 1:228937054-228937076 CTCCATCCTGGCATTGGTGCAGG - Intergenic
923651046 1:235874299-235874321 CTGTATACTTGCAATGTTCAAGG + Intronic
1062848784 10:727522-727544 GTGTTTCCCTGCAACGGTGCCGG - Intergenic
1066959041 10:42203159-42203181 CTCTATCCTGGCAATGTTCCTGG + Intergenic
1070304447 10:75231676-75231698 CTTTTTCCTTTCAATGATGCAGG - Intergenic
1077625593 11:3768569-3768591 CTGTTTCCTTACCATGGTGTTGG + Exonic
1077889641 11:6409928-6409950 CTGTATCCTTGCAATGGTGCTGG + Intronic
1081291414 11:41330079-41330101 TTGTATCCATGCAATCATGCAGG + Intronic
1081884322 11:46481871-46481893 GTGTATCATAGCAATGCTGCTGG + Intronic
1082278912 11:50248684-50248706 CTTTATCCTTGCGAAGGAGCAGG + Intergenic
1082618234 11:55388942-55388964 TTGTATCCTTGCATTGCTGGTGG + Intergenic
1084082505 11:66837789-66837811 CTGTATTCTTGAAAAGGAGCTGG + Intronic
1086689896 11:89777520-89777542 ATGTGTCCTTTCAATGTTGCTGG + Intergenic
1086698771 11:89875454-89875476 ATGTGTCCTTTCAATGTTGCTGG - Intronic
1086707399 11:89969045-89969067 ATGTGTCCTTTCAATGTTGCTGG + Intronic
1086715960 11:90062435-90062457 ATGTGTCCTTTCAATGTTGCTGG - Intergenic
1087064358 11:94013136-94013158 CCCTATCCATTCAATGGTGCTGG + Intergenic
1090730467 11:129569312-129569334 AGGTATCCGTGCAATGGTGGGGG + Intergenic
1090988599 11:131795829-131795851 GTGCATTCTTGCCATGGTGCAGG - Intronic
1092533620 12:9365869-9365891 CTGTGACCTTACAATGGTGACGG - Intergenic
1098249194 12:68551320-68551342 CAGTATACTTGCAGTGGTGAGGG + Intergenic
1100605580 12:96149641-96149663 CTGCATCCCTGCAAAGGTTCTGG + Intergenic
1104314409 12:127683645-127683667 CTGCATCCTCACAAAGGTGCTGG + Intergenic
1107884691 13:44865703-44865725 CTGTCTCCTTGCGATGGTCCAGG + Intergenic
1108092891 13:46868007-46868029 CTGTCTCTTTGCAGTGGTGCTGG - Intronic
1111178895 13:84636076-84636098 GTGCATGCTTGCAATGGTGGTGG - Intergenic
1114398501 14:22388198-22388220 CTGTATCTTTTCAATTTTGCTGG - Intergenic
1115644945 14:35362515-35362537 CTGTCTCCATGGAATGGTGAGGG + Intergenic
1117500846 14:56349907-56349929 CTTTATCCTGGCAATTGTGGAGG - Intergenic
1117915918 14:60677651-60677673 CTGCATCTTTGCTATGATGCTGG - Intergenic
1119376231 14:74195823-74195845 CTTTATCCTTGCTCTGCTGCAGG - Intronic
1120544570 14:85794906-85794928 CTGTATCTTTACAGAGGTGCTGG + Intergenic
1120592910 14:86396760-86396782 CTATATCCTTTCAGTGGTGAAGG - Intergenic
1120725135 14:87930404-87930426 GGGTATCCTTGCCTTGGTGCTGG - Intronic
1124219534 15:27837519-27837541 CTGGCTCCTTGCAAGGGTGTGGG - Intronic
1134414973 16:14035168-14035190 CAGTCTCCTTGCATTGGTGCAGG - Intergenic
1139348241 16:66318355-66318377 CTGTATTCTTGGCATCGTGCAGG + Intergenic
1140523604 16:75603471-75603493 CTAAATCCTTTCAAGGGTGCTGG + Intronic
1141887537 16:86902778-86902800 CTGCATCCTTGCATTAATGCGGG + Intergenic
1141941716 16:87280501-87280523 CTGTATCCAAGCAATTCTGCTGG - Intronic
1142246487 16:88972523-88972545 CTGTCCCCTTGCGATGCTGCTGG + Intronic
1144584704 17:16481180-16481202 CTCTCTCCTGGCAATGGTCCTGG - Intronic
1146482316 17:33214506-33214528 CTTTATCCTTCAATTGGTGCTGG + Intronic
1146623824 17:34420937-34420959 CTCCATCCTTCCAATGGTCCAGG + Intergenic
1155839607 18:30629694-30629716 CTGTCTCCTTCCAATGGAGATGG - Intergenic
1157751914 18:50186741-50186763 CAGTAACCTTCCCATGGTGCAGG + Intronic
1158529107 18:58242292-58242314 TTGTATGTTTGGAATGGTGCTGG + Intronic
1160596915 18:79982197-79982219 CTGCTTCCTTGCCCTGGTGCTGG - Intronic
1160892158 19:1384720-1384742 ATGTTTCCTAGCTATGGTGCAGG - Intronic
1166135597 19:40775361-40775383 CCCTATCCTTGAAATGGTTCTGG + Exonic
926256805 2:11210429-11210451 CAGTATTCCTGCAATGATGCAGG - Intronic
926494047 2:13561884-13561906 CTGTATACCTGCCCTGGTGCTGG + Intergenic
928859469 2:35839462-35839484 CCTTGTCCTTGCAATGGTGCAGG + Intergenic
930521771 2:52476541-52476563 CTTTATCCTTCCAATGGTGAGGG + Intergenic
933461151 2:82587476-82587498 GTTTATCCTTTCAATGTTGCGGG - Intergenic
935609151 2:105002737-105002759 CTGTTTTCTAGCAATGCTGCAGG - Intergenic
937472451 2:122185861-122185883 ATGTATCCATGCAATGGCGCTGG - Intergenic
941140359 2:161773175-161773197 CTGTATCATTCCCATGGTGGAGG + Intronic
944388852 2:199196121-199196143 CTGTTTCCTTGGCATGGTGAAGG + Intergenic
944927477 2:204479773-204479795 ATGAATCATTGCAATGGTGTGGG - Intergenic
945466476 2:210175434-210175456 CTTTATCCTTTCAAAGGTGATGG - Intergenic
947012722 2:225583299-225583321 CTAAATTCTTGCAATGGTCCTGG + Intronic
1170818638 20:19736817-19736839 CTGTATCCTTGTTTTGGTGGTGG - Intergenic
1171181401 20:23093606-23093628 CTGGGTCTTTGCAAGGGTGCGGG - Intergenic
1172608150 20:36229532-36229554 CCGCATCCTTGCACTGCTGCTGG + Exonic
1174684310 20:52438802-52438824 CTGTATCCTTACAAAACTGCTGG - Intergenic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1178017388 21:28365048-28365070 CTGTATTATTGTAATGGTGGTGG - Intergenic
1180719064 22:17893387-17893409 CTGAATCCTGGCTATGTTGCAGG + Intronic
1181802171 22:25354812-25354834 CTGTATCTTTGCCATTCTGCAGG - Exonic
1183988685 22:41583781-41583803 CTGCATCTTTACAATGCTGCTGG - Intronic
951904673 3:27692880-27692902 GTGTGTCCTTGCCATGTTGCAGG - Intergenic
961645107 3:128388701-128388723 CTGTGTGCTTTCAGTGGTGCCGG + Intronic
962111128 3:132449500-132449522 CTGTATTCTTGGATTAGTGCAGG + Intronic
965241675 3:166208440-166208462 CTGTCTCCTTGCACTGGATCAGG + Intergenic
970909143 4:21254257-21254279 CTGTACAGTTGCAATGGTACTGG - Intronic
975739742 4:77418223-77418245 CTGTACACTTGCCATGGTGTAGG - Intronic
978851980 4:113349484-113349506 CTGATACCTTGCAATGGAGCAGG + Intronic
979887786 4:126051895-126051917 ATATATGCTTGCAATGCTGCTGG + Intergenic
985644692 5:1079377-1079399 CTGTATCCTTGGAGGGGTGCAGG - Exonic
987895088 5:23934295-23934317 GTGTATCCATACAATGGTGATGG - Intergenic
996557606 5:124795290-124795312 CTGTATTCTTACAATGATGTAGG + Intergenic
996809536 5:127500379-127500401 CTGTATGCTTGCATTGTTGAGGG - Intergenic
998065342 5:139153403-139153425 CTCTGTCCTTGCAATGGTTAAGG - Intronic
998172823 5:139882483-139882505 CTGTCTCCTTGGCCTGGTGCCGG + Intronic
998806576 5:145922732-145922754 CTGTAGCCTTGAAATGCTTCTGG - Intergenic
999639211 5:153654757-153654779 ATGTCTCCTTGCAACAGTGCAGG + Intronic
999936340 5:156490044-156490066 CTTTATCCTTGCATTTGTGTCGG - Intronic
999948674 5:156625141-156625163 CTGCATCATTCCTATGGTGCTGG - Intronic
1000154509 5:158537408-158537430 CAGAATCCTTGCATTGCTGCAGG - Intergenic
1003131243 6:3396926-3396948 CTGTGTCCTTGCAATAAGGCAGG + Intronic
1005872088 6:29982093-29982115 CTGTCTCCATTCAATAGTGCAGG + Intergenic
1012305774 6:97654893-97654915 CTGTGTCCTTGCAATGGGACAGG + Intergenic
1012353119 6:98278015-98278037 CTCAGTCCTTGCAATGGTCCTGG + Intergenic
1016698352 6:147024710-147024732 CTTTATCTTTGCAATGCTACAGG - Intergenic
1019821430 7:3246108-3246130 CTGTGTCCTCTAAATGGTGCAGG + Intergenic
1024479572 7:49850035-49850057 CAGTATCCTAGCACAGGTGCAGG + Intronic
1028888337 7:95959317-95959339 CTGAACCCTTCCAATGTTGCTGG - Intronic
1034839392 7:154381789-154381811 ATTTATCTTTGCAATGGTGCAGG + Intronic
1037320025 8:17633041-17633063 CTGTATTCTAGCAAAGGGGCGGG - Intronic
1037802145 8:22041645-22041667 CTGTATCCCTACAATGAAGCAGG + Intergenic
1040389502 8:46937691-46937713 CTGCATCCTTGCATTGGAGTTGG + Intergenic
1040517572 8:48147201-48147223 CTGTTTCCTTGCACTGGGGTTGG + Intergenic
1040938545 8:52808052-52808074 CTGTATCCTGATAATGGTGGTGG - Intergenic
1041392079 8:57355825-57355847 GTTTATTCTTGCATTGGTGCTGG - Intergenic
1041456858 8:58070239-58070261 CTGTGTTCTTGCAACGGTGGAGG + Intronic
1044173878 8:89092227-89092249 AAGTATCCTTGCAATGCTACTGG + Intergenic
1045220604 8:100195830-100195852 CTGTATCCTGACTATGGTGATGG - Intronic
1046474166 8:114718960-114718982 CTGTGTCTTTGCAATGTAGCAGG + Intergenic
1056844646 9:90026652-90026674 CTGTAACCCTCCAATGGTGTAGG + Intergenic
1058958734 9:109972814-109972836 TTTAATCCTTGCAATTGTGCAGG - Intronic
1060519540 9:124286635-124286657 CTGTTTCCTTGCAGTGCTCCTGG + Intronic
1060600590 9:124874894-124874916 CTGTGTCCTTGCTTTGGTGTGGG + Intronic
1061416633 9:130450781-130450803 CTGCATCACTGCAATGGTGATGG + Intronic
1061814619 9:133187071-133187093 CTGTCTCCTTGAATTGGTGCTGG + Intergenic
1186039364 X:5459249-5459271 CTGTATCCTTGGCATGGTTAAGG - Intergenic
1189633131 X:42976026-42976048 CTGTCTGTTTGCAATGCTGCAGG - Intergenic
1189767449 X:44386141-44386163 CTGTATTCTTGAAGTGGAGCAGG - Intergenic
1190115404 X:47623354-47623376 CTGTATACTAACAATAGTGCTGG - Intergenic
1192270735 X:69577017-69577039 CTGTATCCTGGCTGTGGTGGTGG - Intergenic
1197078287 X:122378977-122378999 CTGTCTCCATGCATGGGTGCTGG + Intergenic