ID: 1077889766

View in Genome Browser
Species Human (GRCh38)
Location 11:6410755-6410777
Sequence AGGCCCCAAGCCCTTACAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 132}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077889766_1077889782 21 Left 1077889766 11:6410755-6410777 CCATCTGTAAGGGCTTGGGGCCT 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1077889782 11:6410799-6410821 CAGGGGCTCAGGCAGCCCTGGGG 0: 1
1: 0
2: 6
3: 71
4: 680
1077889766_1077889777 10 Left 1077889766 11:6410755-6410777 CCATCTGTAAGGGCTTGGGGCCT 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1077889777 11:6410788-6410810 TCCACACTCTCCAGGGGCTCAGG 0: 1
1: 0
2: 2
3: 31
4: 275
1077889766_1077889773 2 Left 1077889766 11:6410755-6410777 CCATCTGTAAGGGCTTGGGGCCT 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1077889773 11:6410780-6410802 GAGGGGCCTCCACACTCTCCAGG 0: 1
1: 0
2: 5
3: 19
4: 212
1077889766_1077889775 4 Left 1077889766 11:6410755-6410777 CCATCTGTAAGGGCTTGGGGCCT 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1077889775 11:6410782-6410804 GGGGCCTCCACACTCTCCAGGGG 0: 1
1: 0
2: 2
3: 19
4: 163
1077889766_1077889783 22 Left 1077889766 11:6410755-6410777 CCATCTGTAAGGGCTTGGGGCCT 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1077889783 11:6410800-6410822 AGGGGCTCAGGCAGCCCTGGGGG 0: 1
1: 0
2: 13
3: 70
4: 513
1077889766_1077889774 3 Left 1077889766 11:6410755-6410777 CCATCTGTAAGGGCTTGGGGCCT 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1077889774 11:6410781-6410803 AGGGGCCTCCACACTCTCCAGGG 0: 1
1: 0
2: 4
3: 20
4: 237
1077889766_1077889781 20 Left 1077889766 11:6410755-6410777 CCATCTGTAAGGGCTTGGGGCCT 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1077889781 11:6410798-6410820 CCAGGGGCTCAGGCAGCCCTGGG 0: 1
1: 1
2: 10
3: 80
4: 585
1077889766_1077889779 19 Left 1077889766 11:6410755-6410777 CCATCTGTAAGGGCTTGGGGCCT 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1077889779 11:6410797-6410819 TCCAGGGGCTCAGGCAGCCCTGG 0: 1
1: 0
2: 5
3: 62
4: 496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077889766 Original CRISPR AGGCCCCAAGCCCTTACAGA TGG (reversed) Exonic
900959519 1:5910152-5910174 AGACCCCAAGCCCATCCTGACGG + Intronic
901042035 1:6370057-6370079 TGGCACCATGCCCTTCCAGAGGG - Intronic
902700173 1:18167070-18167092 AGGCCACAAGTGCTTGCAGAGGG + Intronic
903022143 1:20401878-20401900 AGGCCCCAGGCCATGAGAGAAGG - Intergenic
903548527 1:24142017-24142039 AGGCTCCCAGCCCTTTGAGATGG - Intronic
904047252 1:27616069-27616091 AGGCCCCCAGTCCTTACAGAAGG - Intronic
904253230 1:29238818-29238840 AAGCCCCAAGCCCTGCCAGCAGG + Intronic
905285797 1:36879598-36879620 AAGTCCCAGGCCCTTAGAGAGGG - Intronic
905393946 1:37655547-37655569 AGGCCCCAGGCCCCAACAGCTGG + Intergenic
907423709 1:54365019-54365041 AGGCCCCAGGCCTGCACAGAGGG + Intronic
914899863 1:151706170-151706192 AGTCCCCAAGCCCATAACGAGGG + Intronic
915082630 1:153362385-153362407 AGCCCCCAGGCCCTTAAAGCAGG - Intergenic
921859085 1:220022193-220022215 AGGCTACATGCCTTTACAGAAGG + Intronic
922723952 1:227914031-227914053 AGGCACCATGCCCTGTCAGAAGG - Intergenic
1066681935 10:37942971-37942993 AGGCCCCATGCCCTTAAACTAGG + Intergenic
1066682108 10:37944238-37944260 AGGCCCCATGCCCTTACACTAGG - Intergenic
1072068303 10:91891757-91891779 AGGCACCAACCCCTTAGATAGGG - Intergenic
1074435023 10:113426618-113426640 TGGCCCCAGGCACGTACAGAAGG - Intergenic
1076462988 10:130659051-130659073 AGGCCCCCAGCCCCTCCAGATGG - Intergenic
1076718747 10:132383172-132383194 AGGGCCCATGTCCTGACAGAGGG - Intergenic
1077644459 11:3911076-3911098 ATAAACCAAGCCCTTACAGAAGG - Intronic
1077889766 11:6410755-6410777 AGGCCCCAAGCCCTTACAGATGG - Exonic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1083781450 11:64920324-64920346 AGGCACCAACCCCTAAGAGACGG - Intronic
1084101827 11:66954980-66955002 AGGCCTCCAGCCCATGCAGAAGG + Intronic
1084510008 11:69597484-69597506 AGGCCCCAGGTCCATACTGAAGG + Intergenic
1085262897 11:75218470-75218492 AGACCCCAGGCCTTTAGAGAGGG + Intergenic
1088040831 11:105379738-105379760 AGGCCCCAATCCCTTCCATGAGG - Intergenic
1091085025 11:132713084-132713106 AGCTCCCAAGCTCTTTCAGATGG - Intronic
1091169617 11:133508489-133508511 GGGCCCCATGCCCTTGAAGAGGG + Intronic
1092090889 12:5802872-5802894 CTGCCCCAAGCCTTTACAGCAGG + Intronic
1092597309 12:10021645-10021667 AGCCAACAAGCCCTTACTGAGGG + Intergenic
1096817388 12:54210191-54210213 ACGCCCCCATCCCTTACAGAGGG + Intergenic
1103694069 12:122799877-122799899 AGGCCACAACCCCTCGCAGAGGG - Intronic
1105286960 13:19012322-19012344 AGGCCCCTCACCCTTGCAGAGGG - Intergenic
1105572427 13:21615699-21615721 AGGCCACCAGTCCATACAGAAGG + Intergenic
1106540555 13:30686453-30686475 AGGCACCAAGCCATTCAAGAGGG - Intergenic
1107933713 13:45327329-45327351 AGGGCCCAAGCCTGTAGAGAAGG + Intergenic
1108158936 13:47618229-47618251 ATGCCCAAACCCCTTACAGGAGG + Intergenic
1117014667 14:51506416-51506438 AGGCTCCAAGAGATTACAGAAGG + Intronic
1117199165 14:53370902-53370924 AGGGTCCAAGCCCCTGCAGAAGG + Intergenic
1117289293 14:54316851-54316873 AGGCCCCTCGCCCTTGCACAAGG - Intergenic
1121952469 14:98183688-98183710 ACGCCCTAAGTCCTGACAGAGGG + Intergenic
1122102460 14:99424392-99424414 AGACCCCAGGCCCTCCCAGAGGG + Intronic
1122283561 14:100638320-100638342 AGGCCCCAAGCCCACACTGGGGG + Intergenic
1123811863 15:23935063-23935085 TGGCACCAAGCCATTACTGAAGG - Intergenic
1125331553 15:38587578-38587600 AGGCCCAAAGCCCTCAGAAAAGG - Intergenic
1125731367 15:41894342-41894364 AGGCCCCAAGAGGGTACAGAGGG - Intergenic
1128345229 15:66849045-66849067 AGCCCTCCAGCCCTTAGAGAGGG + Intergenic
1129879411 15:78996961-78996983 AGGGCCCAAGCCCTCACACCTGG + Intronic
1130251585 15:82303569-82303591 AGGCCACAAGCCCTTTTCGAGGG + Intergenic
1130546459 15:84860131-84860153 AGATTCCAAGCCCTTAAAGAGGG - Intronic
1132643487 16:988422-988444 AAGCCACAAGCCCTGCCAGAGGG - Intergenic
1132852906 16:2032887-2032909 AGCCCCCAAGGCCCTCCAGATGG - Intronic
1135177271 16:20241494-20241516 AGGCACTAAGCCCTTACATTGGG + Intergenic
1147607372 17:41781863-41781885 AGGCCCGATGCACTTACTGAAGG - Intronic
1148694189 17:49549274-49549296 AGGACCCAGGCCCTGAGAGATGG - Intergenic
1149661400 17:58335945-58335967 GGGCCCCAGGCCCATGCAGATGG - Intergenic
1150139853 17:62718433-62718455 TGGCCCCAAGCCTTTCCACATGG - Intronic
1152224282 17:79085532-79085554 AGGCCCCAAGCCACAGCAGAAGG - Intronic
1152356237 17:79809059-79809081 AGGCCCCAAGGCCTCACCGGTGG - Intergenic
1152724093 17:81936831-81936853 TGGCCCAAAGCCCCCACAGATGG + Exonic
1155437629 18:25829776-25829798 AGGGCCCCAGCCATCACAGATGG + Intergenic
1159726641 18:71968213-71968235 AGCTCTCAACCCCTTACAGAAGG - Intergenic
1161979180 19:7621609-7621631 AGGCCGCACCCCCTGACAGAGGG + Intronic
1163296400 19:16415678-16415700 AGGCCCCAGCCTCCTACAGATGG + Intronic
1165246933 19:34503233-34503255 TGGCCACCAGCCCTGACAGAAGG - Exonic
929541278 2:42824339-42824361 AGGCTCTAAGCCCAGACAGAAGG + Intergenic
932089450 2:68791931-68791953 AAGTCACAAGCCCTTAGAGAAGG - Intronic
933886596 2:86723462-86723484 AGGTCCAAAGTCCTGACAGAGGG - Intronic
933923584 2:87073243-87073265 AGGTCCAAAGTCCTGACAGAGGG + Intergenic
933989298 2:87622277-87622299 AAGCCCCAAGCCCCTAAAAATGG + Intergenic
935379803 2:102440104-102440126 AGGCACCAAGACCTTTCATAGGG + Intronic
936304545 2:111328549-111328571 AAGCCCCAAGCCCCTAAAAATGG - Intergenic
937856320 2:126674332-126674354 AGGCCCCAACCTCTTAGAAATGG + Intronic
938079823 2:128363938-128363960 ACGCTCCAAGCCCTTGCAAAGGG - Intergenic
940836962 2:158533108-158533130 AGGAACCAAGGCTTTACAGATGG - Intronic
943740234 2:191399626-191399648 AGGCCTGGAGCCCTTTCAGAGGG + Intronic
944519539 2:200550570-200550592 AGGTCCCAAGAACTTACAAAGGG + Intronic
945470489 2:210223546-210223568 AGCCCCCCAGCCCATTCAGAGGG + Intronic
946088746 2:217200455-217200477 AGTCCCCCACCCCCTACAGAGGG + Intergenic
948360436 2:237416471-237416493 AGGCCCCAATCCCTGAAGGAAGG - Intergenic
1168961659 20:1874347-1874369 GGGCCTCCAGCCTTTACAGAAGG - Intergenic
1171810108 20:29740826-29740848 CGGCCACAAGCCCTGCCAGACGG + Intergenic
1177841992 21:26245173-26245195 AGGCCCCATCCCCTGACACATGG - Intergenic
1180123195 21:45767795-45767817 AGGCCCCAGGCCCCTGCAGGTGG + Intronic
1183181802 22:36265305-36265327 AGGCTCCGTGCCCTTGCAGATGG + Exonic
1184110065 22:42389264-42389286 AGGCCCCCAACCCATACAGTGGG + Intronic
952625927 3:35403310-35403332 AGGCACCAAGCACTTACATGTGG - Intergenic
952747509 3:36795103-36795125 AGGCCAAAAACCCTTTCAGATGG - Intergenic
952884018 3:38001939-38001961 AGGCCCCAGGCCCAAAGAGAAGG - Intronic
953937842 3:47061384-47061406 AGGCACCAAGAACTTACAGTAGG + Intronic
954338522 3:49934972-49934994 AGGCCCTAGGCCTTTACTGATGG - Intergenic
956449566 3:69359965-69359987 AGGGCCCATGCTCTTACAAATGG + Intronic
960726150 3:120672386-120672408 GGGACCCAAGTCCTTTCAGAGGG + Intronic
966965071 3:184983311-184983333 AGGCCGCACGCCCTAACTGAAGG - Intronic
969017722 4:4115591-4115613 AGGTCCCAAGCCCTGGCACACGG - Intergenic
970581357 4:17477005-17477027 AGGCCCCAGGCTATTCCAGAAGG + Intronic
975802247 4:78072993-78073015 AGGAAAGAAGCCCTTACAGAAGG + Intronic
984386892 4:179072294-179072316 AGGACCCAATTCCTCACAGATGG + Intergenic
985961206 5:3304625-3304647 AGGCCCCCAGCCCTCCCTGAAGG - Intergenic
986334381 5:6742301-6742323 AGGCCCCAGCCCCTCACAGCAGG - Intronic
986778792 5:11045447-11045469 AGGCACCAAGCCATTACTGAGGG + Intronic
988244555 5:28662734-28662756 ATGCCCAAAGCCAGTACAGATGG - Intergenic
988422979 5:31029105-31029127 AGCCCCCAGTACCTTACAGAAGG + Intergenic
990617926 5:57526375-57526397 AGGCACCAAGCCCTTCCTGAAGG - Intergenic
994097901 5:95863535-95863557 AAACCCCAAGCCCTGGCAGAGGG - Intergenic
997481206 5:134185937-134185959 AAGCCGCAAGACCTTTCAGAAGG + Intronic
999122017 5:149217061-149217083 AGGTCGGAAGGCCTTACAGAGGG - Intronic
999226226 5:150027028-150027050 AGACCACAAGTCCTCACAGAGGG - Exonic
1000805810 5:165790082-165790104 AGGCACCAAGAACTTACAAAAGG - Intergenic
1001200315 5:169710165-169710187 GGACCCTAAGCTCTTACAGATGG - Intronic
1002373094 5:178770077-178770099 AGGCCCCAAGACTTTGCAGATGG + Intergenic
1005820159 6:29591903-29591925 AGTCCCCAAGCCCCTAAAAAGGG - Intronic
1006321467 6:33321974-33321996 AGGCCCCATCCCCTTCCAGCAGG - Exonic
1007753584 6:44084449-44084471 AGGCCCCAGGCCCTGGCAGCTGG - Intergenic
1008500927 6:52182222-52182244 ACTCCCCAAGGCCTTCCAGATGG + Intergenic
1009319546 6:62270179-62270201 AGGCACCAAGCCATTAATGAGGG - Intronic
1009389543 6:63129510-63129532 GGGCCCCAATCCCTTCCAGCTGG + Intergenic
1013207713 6:107959191-107959213 TTTCCCCAAGCCGTTACAGATGG + Intergenic
1019938179 7:4269817-4269839 AGGCCCAAAGCCCTGCAAGATGG - Intergenic
1020565454 7:9788854-9788876 AGGTACCAAGCCATTCCAGAGGG + Intergenic
1023478764 7:40610131-40610153 AGGCCCCAAGCCACTCCAGAAGG - Intronic
1030141695 7:106310831-106310853 CGGCCCCAAGCCATTAATGAGGG + Intergenic
1031960953 7:127989342-127989364 GAGCCCCAAGGCCTTACAAATGG - Intronic
1045439852 8:102198352-102198374 AGGCCACCAGCCCTTTGAGATGG + Intergenic
1046462664 8:114562223-114562245 AGGCTACAAGCCCATACAGAAGG - Intergenic
1049296538 8:141843457-141843479 AGACGCCAACCCCCTACAGAGGG - Intergenic
1051518998 9:17962958-17962980 TGGCCCCAAGCCCTGACACAGGG - Intergenic
1052998104 9:34562237-34562259 TAGCCCCAGGCCCTTTCAGAGGG - Intronic
1053782149 9:41621379-41621401 AGGCTACAAGCCCTTACATCAGG + Intergenic
1054170099 9:61831534-61831556 AGGCTACAAGCCCTTACATCAGG + Intergenic
1054667439 9:67749281-67749303 AGGCTACAAGCCCTTACATCAGG - Intergenic
1055353394 9:75412586-75412608 AAGCCCAAAGCCCTTCCAAATGG - Intergenic
1056381879 9:86063263-86063285 AGGCCTCCAGCCCTTGCACAGGG - Intronic
1056593925 9:87989596-87989618 AGGCACCAAGCCATTACTGAGGG + Intergenic
1056597943 9:88023012-88023034 GGTCACCAAGCCCTTCCAGAGGG - Intergenic
1056792009 9:89632069-89632091 ATGCCCCAACCCCCTCCAGAGGG - Intergenic
1058747939 9:108009883-108009905 AAGCCCCAGGACCTTGCAGAAGG + Intergenic
1061293371 9:129665100-129665122 AGGCCCCAGGCCCTTCCCCAAGG - Intergenic
1061570838 9:131476620-131476642 AGGCCCCCAGCCCCGACACACGG - Intronic
1197734495 X:129840767-129840789 AAGCCTGAAGCCCTCACAGAAGG + Intronic
1197884173 X:131200701-131200723 AGGCCCCAAAACCTTTGAGATGG - Intergenic
1199976887 X:152899416-152899438 AGGCACCAAGGCCTGCCAGAAGG - Intergenic