ID: 1077889800

View in Genome Browser
Species Human (GRCh38)
Location 11:6410884-6410906
Sequence GAGGGAGAGGAGAAGGCGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2174
Summary {0: 1, 1: 0, 2: 17, 3: 204, 4: 1952}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077889800_1077889810 11 Left 1077889800 11:6410884-6410906 CCGGCCGCCTTCTCCTCTCCCTC 0: 1
1: 0
2: 17
3: 204
4: 1952
Right 1077889810 11:6410918-6410940 GCTCTTGAGTGCTGATGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 178
1077889800_1077889811 16 Left 1077889800 11:6410884-6410906 CCGGCCGCCTTCTCCTCTCCCTC 0: 1
1: 0
2: 17
3: 204
4: 1952
Right 1077889811 11:6410923-6410945 TGAGTGCTGATGATCAGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 131
1077889800_1077889812 26 Left 1077889800 11:6410884-6410906 CCGGCCGCCTTCTCCTCTCCCTC 0: 1
1: 0
2: 17
3: 204
4: 1952
Right 1077889812 11:6410933-6410955 TGATCAGGCCAGGTCCTCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077889800 Original CRISPR GAGGGAGAGGAGAAGGCGGC CGG (reversed) Exonic
Too many off-targets to display for this crispr