ID: 1077889810

View in Genome Browser
Species Human (GRCh38)
Location 11:6410918-6410940
Sequence GCTCTTGAGTGCTGATGATC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 178}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077889799_1077889810 12 Left 1077889799 11:6410883-6410905 CCCGGCCGCCTTCTCCTCTCCCT 0: 1
1: 0
2: 5
3: 93
4: 1019
Right 1077889810 11:6410918-6410940 GCTCTTGAGTGCTGATGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 178
1077889795_1077889810 25 Left 1077889795 11:6410870-6410892 CCTCCTCGGCCTCCCCGGCCGCC 0: 1
1: 1
2: 25
3: 203
4: 2127
Right 1077889810 11:6410918-6410940 GCTCTTGAGTGCTGATGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 178
1077889805_1077889810 -7 Left 1077889805 11:6410902-6410924 CCCTCATCTGGCCCCTGCTCTTG 0: 1
1: 0
2: 3
3: 36
4: 438
Right 1077889810 11:6410918-6410940 GCTCTTGAGTGCTGATGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 178
1077889794_1077889810 28 Left 1077889794 11:6410867-6410889 CCTCCTCCTCGGCCTCCCCGGCC 0: 1
1: 2
2: 14
3: 213
4: 1859
Right 1077889810 11:6410918-6410940 GCTCTTGAGTGCTGATGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 178
1077889806_1077889810 -8 Left 1077889806 11:6410903-6410925 CCTCATCTGGCCCCTGCTCTTGA 0: 1
1: 0
2: 1
3: 30
4: 373
Right 1077889810 11:6410918-6410940 GCTCTTGAGTGCTGATGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 178
1077889796_1077889810 22 Left 1077889796 11:6410873-6410895 CCTCGGCCTCCCCGGCCGCCTTC 0: 1
1: 0
2: 10
3: 62
4: 612
Right 1077889810 11:6410918-6410940 GCTCTTGAGTGCTGATGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 178
1077889803_1077889810 4 Left 1077889803 11:6410891-6410913 CCTTCTCCTCTCCCTCATCTGGC 0: 1
1: 1
2: 6
3: 80
4: 984
Right 1077889810 11:6410918-6410940 GCTCTTGAGTGCTGATGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 178
1077889797_1077889810 16 Left 1077889797 11:6410879-6410901 CCTCCCCGGCCGCCTTCTCCTCT 0: 1
1: 0
2: 4
3: 100
4: 849
Right 1077889810 11:6410918-6410940 GCTCTTGAGTGCTGATGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 178
1077889798_1077889810 13 Left 1077889798 11:6410882-6410904 CCCCGGCCGCCTTCTCCTCTCCC 0: 1
1: 0
2: 8
3: 130
4: 993
Right 1077889810 11:6410918-6410940 GCTCTTGAGTGCTGATGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 178
1077889804_1077889810 -2 Left 1077889804 11:6410897-6410919 CCTCTCCCTCATCTGGCCCCTGC 0: 1
1: 1
2: 12
3: 92
4: 712
Right 1077889810 11:6410918-6410940 GCTCTTGAGTGCTGATGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 178
1077889801_1077889810 7 Left 1077889801 11:6410888-6410910 CCGCCTTCTCCTCTCCCTCATCT 0: 1
1: 1
2: 54
3: 748
4: 4990
Right 1077889810 11:6410918-6410940 GCTCTTGAGTGCTGATGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 178
1077889800_1077889810 11 Left 1077889800 11:6410884-6410906 CCGGCCGCCTTCTCCTCTCCCTC 0: 1
1: 0
2: 17
3: 204
4: 1952
Right 1077889810 11:6410918-6410940 GCTCTTGAGTGCTGATGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077889810 Original CRISPR GCTCTTGAGTGCTGATGATC AGG Exonic
904327419 1:29736301-29736323 TTTCTTCAGTGCTGATGGTCTGG + Intergenic
905472030 1:38200114-38200136 GCTCTTGTCTGCAGCTGATCTGG - Intergenic
908167515 1:61472994-61473016 GCTCTTGTCTGCAGCTGATCTGG + Intergenic
910049373 1:82957502-82957524 GTTCTTGTGTGCTGGTGATGTGG - Intergenic
912659137 1:111513089-111513111 GCTCTTGGGGGCTGGTGACCTGG - Intronic
912662791 1:111548476-111548498 GCTCTTTTGTGCAGCTGATCTGG + Intronic
913676323 1:121144253-121144275 GCTCTTGCCTGCAGCTGATCTGG - Intergenic
914028218 1:143932203-143932225 GCTCTTGCCTGCAGCTGATCTGG - Intergenic
915146915 1:153800805-153800827 GCTCCTGACTGCTGATGTCCTGG + Intergenic
915902612 1:159857261-159857283 GCTATTGAGAGCAGATGATAAGG - Intronic
919591859 1:199513894-199513916 GCACTTGAATGCTGATGAGATGG - Intergenic
920463689 1:206163094-206163116 GCTCTTGCCTGCAGCTGATCTGG - Intergenic
923229696 1:231973514-231973536 GATCATGAATGCTGTTGATCTGG + Intronic
924244568 1:242071632-242071654 GCTCTTGTCTGCAGCTGATCTGG - Intergenic
1063875164 10:10468498-10468520 GCTGTTGATTGCTGTTGATCTGG + Intergenic
1066444162 10:35466450-35466472 GCTCTGTAGGGGTGATGATCAGG + Intronic
1068565155 10:58566743-58566765 GCTCAACATTGCTGATGATCAGG - Intronic
1068596796 10:58910765-58910787 TCTCCTGAATGCTGAGGATCGGG + Intergenic
1068647683 10:59486296-59486318 GCTCTTGTCTGCAGCTGATCTGG + Intergenic
1070269195 10:74935797-74935819 GCTTTTGAGTGATGATGATTAGG + Intronic
1071196865 10:83171331-83171353 GCTCTTGACTGTAGCTGATCTGG - Intergenic
1074308196 10:112298380-112298402 GCTCGTGAGGGCAGATGCTCAGG + Intronic
1074808453 10:117078116-117078138 GCTCTTGTCTGCAGCTGATCTGG - Intronic
1075875318 10:125801132-125801154 GCGCCTGAGTGCTGATAATAAGG + Intronic
1075923006 10:126228684-126228706 GCTTTTAAGTTCTGATTATCAGG + Intronic
1076232058 10:128828701-128828723 GCTCTTGTTTGCAGCTGATCTGG - Intergenic
1077889810 11:6410918-6410940 GCTCTTGAGTGCTGATGATCAGG + Exonic
1078923949 11:15857583-15857605 CCTCTTGAGTGCTCATGTCCAGG - Intergenic
1080753454 11:35172342-35172364 GCTCTTGGTTGCAGCTGATCTGG + Intronic
1080994454 11:37582146-37582168 GTTCTTGTGTGCTGAAGATGTGG + Intergenic
1081067404 11:38562659-38562681 GCTCTTGTCTGCAGCTGATCTGG - Intergenic
1083497666 11:63072391-63072413 GCTCTTGTCTGCAGCTGATCTGG + Intergenic
1084245604 11:67854934-67854956 GCTCTTGTGTGCTGGAGATGTGG + Intergenic
1084827081 11:71739644-71739666 GCTCTTGGGTGCTGGAGATGTGG - Intergenic
1087099091 11:94347906-94347928 GTTCTTGTGTGCTGGAGATCTGG - Intergenic
1087436204 11:98121036-98121058 GATCATGAGTGCTGATGGTCTGG + Intergenic
1088840110 11:113619657-113619679 GCTCTTGTCTGCAGCTGATCTGG - Intergenic
1088947013 11:114524493-114524515 GCTCTTAAGTCCTGGTGATTTGG + Intronic
1090841940 11:130497659-130497681 GCTCTTGTCTGCAGCTGATCTGG + Intergenic
1091853077 12:3716390-3716412 GCTCTTGTCTGCAGCTGATCTGG + Intronic
1092036778 12:5343052-5343074 GCTCTTGAGTGATGTAGTTCAGG + Intergenic
1092416185 12:8292065-8292087 GCTCTTGTGTGCTGGAGATGTGG + Intergenic
1093128047 12:15353944-15353966 GCTCTTGTCTGCAGCTGATCTGG + Intronic
1093857371 12:24122134-24122156 GCTCTTGTCTGCAGTTGATCTGG - Intergenic
1094129222 12:27056819-27056841 GCTCTTGTCTGCAGCTGATCTGG + Intronic
1094675324 12:32614209-32614231 GCTCTTGTCTGCAGCTGATCTGG - Intronic
1095357734 12:41296152-41296174 GCTCTTGTCTGCAGCTGATCTGG - Intronic
1104294220 12:127497109-127497131 GGTCTTGGGTGCTGATTCTCAGG - Intergenic
1105950589 13:25226102-25226124 GCTCTAGAGTACAGTTGATCTGG - Intergenic
1107676067 13:42798504-42798526 TTTATTGAGTGCTGATGAGCAGG + Intergenic
1109576461 13:64265054-64265076 GCTCTTGTTTGCAGTTGATCTGG - Intergenic
1112193944 13:97206433-97206455 GCTCCTGAGTGTTGATAATTAGG + Intergenic
1113465628 13:110510890-110510912 GCTCTTGTCTGCTAATGAGCAGG - Intronic
1114555072 14:23557150-23557172 GCTCTTGGGAGCTGATGAAGAGG + Exonic
1114992785 14:28309131-28309153 GCTCTTGTCTGCAGTTGATCTGG + Intergenic
1116210854 14:41941515-41941537 GCTCTTGTTTGCGGCTGATCTGG + Intergenic
1116877867 14:50132021-50132043 GCTCTTGTCTGCAGCTGATCTGG - Intronic
1117273854 14:54172353-54172375 CTTCTTGAGTGCTGAGAATCTGG - Intergenic
1117365548 14:55023874-55023896 TCTCTTGACTGCGGATGGTCTGG + Intronic
1117386530 14:55219601-55219623 GCTCTTGTCTGCAGCTGATCTGG - Intergenic
1117933848 14:60878861-60878883 GCTCTTGTCTGCAGCTGATCTGG + Intronic
1118830670 14:69428580-69428602 GCTCTTGTCTGCAGCTGATCTGG - Intronic
1120223315 14:81760299-81760321 GCTCTTGTCTGCAGTTGATCTGG - Intergenic
1120847831 14:89141550-89141572 GCTCTTGTCTGCAGCTGATCTGG + Intronic
1127994126 15:64142715-64142737 GCTCCGGAGTGCTGAAGATGAGG + Intronic
1130668338 15:85888513-85888535 CCTCTTGTGTGCTGATTATCAGG - Intergenic
1131954685 15:97720459-97720481 GCTCTTGTCTGCAGCTGATCTGG + Intergenic
1133651386 16:7816890-7816912 GTTCTTGTGTGCTGAAGATGTGG - Intergenic
1135622821 16:23970440-23970462 GCTTTTGTGTGCTGATGTGCAGG + Intronic
1136288404 16:29257643-29257665 GCTGTTAAGGGCTGATGAGCAGG + Intergenic
1136288432 16:29257764-29257786 GCTGATGAGGGCTGATGAGCAGG + Intergenic
1142094112 16:88230547-88230569 GCTTATGAGGGCTGATGAGCAGG + Intergenic
1142094141 16:88230669-88230691 GCTTATGAGGGCTGATGAGCAGG + Intergenic
1144366571 17:14550296-14550318 TCTCTTGATTTCTGAGGATCTGG + Intergenic
1145882887 17:28364836-28364858 GCTCATGGGTGCTGATGTTGGGG + Exonic
1149617564 17:58014073-58014095 GCTCTTGTGTGCAGCTGATCTGG - Intergenic
1150482912 17:65524341-65524363 GCTCTTGACCTCTGATCATCTGG + Intergenic
1151314477 17:73312990-73313012 GCTCTTGAGAGCTAATGGTTTGG + Intergenic
1151529438 17:74695191-74695213 GACCTTGGGTGCTGAGGATCAGG - Exonic
1151985868 17:77543097-77543119 GCTTTGGAGTGCTTATGAGCTGG + Intergenic
1152091158 17:78248638-78248660 GGCCGTGAGTGCTGATGAGCTGG - Intergenic
1155420219 18:25647812-25647834 ACTCTTCAGTGATGAGGATCTGG - Intergenic
1156361164 18:36385899-36385921 GCTCCTGAGTGCACATGACCAGG + Intronic
1159561563 18:70000711-70000733 GCTCTTGAGTCCTGTGGACCAGG - Intergenic
1164861345 19:31564604-31564626 GTTCTTGACTGGTGATGCTCTGG + Intergenic
1166751392 19:45165420-45165442 GTTCTTGGGGGCTGATGATCTGG - Intronic
1167080889 19:47275368-47275390 GCTCTCGAGGGCTGGCGATCCGG - Exonic
1167677050 19:50893800-50893822 GCCCTTGAGAGCTGATGAAAAGG + Intergenic
1168566060 19:57424804-57424826 GCTCTTGTCTGCAGCTGATCTGG + Intronic
927120863 2:19961474-19961496 GCTCCTGTGTGCAGCTGATCTGG - Intronic
930927161 2:56832093-56832115 GCTCTTGAATCATGATGATAGGG + Intergenic
932229166 2:70068284-70068306 GCTCTGGAGTGCTGAGGAATGGG + Intergenic
933137924 2:78760086-78760108 GTTCTTGAGTGCTGGAGATGTGG - Intergenic
934696583 2:96404711-96404733 GACTTTGAGTGCTGATGAGCAGG - Intergenic
935473225 2:103484855-103484877 GCTCTTGTCTGCAGCTGATCTGG - Intergenic
938784664 2:134615624-134615646 GCTCTTGTTTGCAGCTGATCTGG - Intronic
939202357 2:139053643-139053665 GGTCTTGTGTGCTGATAATGGGG + Intergenic
939548539 2:143584180-143584202 GGTCTTTACTGCTGATTATCTGG - Intronic
939984803 2:148819226-148819248 GCTCTTGTCTGCAGCTGATCTGG - Intergenic
941004510 2:160234280-160234302 GCTCTTGTCTGCAGCTGATCTGG - Intronic
943293549 2:186107671-186107693 GCTCTTAACTGCAGCTGATCTGG - Intergenic
943996464 2:194772416-194772438 GCTCTTGTCTGCAGCTGATCTGG - Intergenic
944276728 2:197847351-197847373 CCTCTGGGGTGCTGAGGATCTGG - Intronic
947539970 2:230969618-230969640 GCTCTTGAGTCCCTATGCTCGGG + Intergenic
947887668 2:233587284-233587306 GTTCTTGTCTGCAGATGATCTGG + Intergenic
1169033824 20:2433512-2433534 GCTCTTGTTTGCAGCTGATCTGG - Intergenic
1169129963 20:3161390-3161412 GCACTTGAGATCTGCTGATCAGG + Intergenic
1170174714 20:13455967-13455989 GCTCTTGTCTGCAGCTGATCTGG - Intronic
1170642118 20:18163696-18163718 GCTCTTCATTGCTGGTGTTCTGG + Intronic
1172560798 20:35886677-35886699 GATGTTAAGTGCTGATGATGAGG + Intronic
1173058260 20:39636841-39636863 TCTCATGAGTGCTGATTACCAGG - Intergenic
1174513432 20:51073231-51073253 GCAGTTGAGTGCTCATGATTCGG + Intergenic
1175283009 20:57817503-57817525 GCTCTTGTCTGCAGCTGATCTGG + Intergenic
1180133917 21:45848187-45848209 GCTCCTGAGTCCCGATGGTCAGG - Intronic
1184051165 22:42005731-42005753 GCTCTTGCCTGCAGCTGATCTGG - Intronic
1185264318 22:49891297-49891319 GCTCTTGTCTGCAGCTGATCTGG + Intergenic
950412064 3:12845162-12845184 ACTCTTGAGCCCTGATGCTCAGG - Intronic
952213842 3:31255881-31255903 GCTTTTGAGGGCTTATGATGTGG - Intergenic
952821404 3:37489333-37489355 GCTCTTGGGTCCTGATGCTGAGG + Intronic
953454986 3:43033735-43033757 GCTCTTGTGAGCTGATGAGCTGG - Intronic
958750994 3:98193187-98193209 GTTCTTGAGTGCTGGAGTTCTGG - Intronic
958790821 3:98649012-98649034 GCTCTTGTCTGCAGCTGATCTGG + Intergenic
959739378 3:109698562-109698584 GCTCTTGTCTGCAGCTGATCTGG + Intergenic
960419532 3:117426736-117426758 GGTCCTGAGCTCTGATGATCTGG + Intergenic
961893722 3:130150662-130150684 GCTCTTGTGTGCTGGAGATGTGG + Intergenic
963559672 3:146847553-146847575 TCTCATGAGTGCTGATCAGCTGG - Intergenic
965049319 3:163624327-163624349 GCTCTTGACTGCAGCTGATCTGG - Intergenic
971083081 4:23238031-23238053 GCTCGTGACTGCTGACCATCTGG + Intergenic
972734513 4:41827653-41827675 GTTCTTGACTGCAGCTGATCTGG + Intergenic
974385066 4:61193661-61193683 GCTCTTGTCTGCAGCTGATCTGG + Intergenic
978332481 4:107629529-107629551 GCTCTTGTCTGCAGCTGATCTGG - Intronic
979859695 4:125677983-125678005 GCACCTGAGTCCTGATGCTCTGG + Intergenic
980996438 4:139784054-139784076 GCTGTTGTGTGCGGATGCTCAGG - Intronic
981202446 4:141996669-141996691 GCTCATCAGTGCTGGTTATCTGG + Intergenic
986001644 5:3635162-3635184 GGGCTTGAGTGCTGATGAGGTGG + Intergenic
988729447 5:33956233-33956255 GCTCTTGTCTGCAGTTGATCTGG - Intronic
989415282 5:41168128-41168150 GCTCTTGTCTGCAGCTGATCTGG - Intronic
989795554 5:45467048-45467070 GCTCTTGAGTGCTTTTTACCTGG + Intronic
990441001 5:55845429-55845451 GCTCTTGAGGGCAGGTGATATGG + Intergenic
990659087 5:57992712-57992734 GCTCTTGTCTGCAGCTGATCTGG + Intergenic
991585322 5:68196172-68196194 GCTCTGGAGAGCGGAAGATCTGG - Intronic
994384796 5:99118520-99118542 GCTCTTGTCTGCAGCTGATCTGG - Intergenic
995235877 5:109829706-109829728 GCTCTTGTCTGCAGCTGATCTGG + Intronic
1001976544 5:176004650-176004672 GCTCTTGTCTGCAGCTGATCAGG + Intronic
1002240884 5:177839122-177839144 GCTCTTGTCTGCAGCTGATCAGG - Intergenic
1003623671 6:7724648-7724670 GCTCTTGAATTCTGAGGGTCCGG + Intergenic
1005370362 6:25125728-25125750 GCTCTTGTCTGCAGCTGATCTGG - Intergenic
1012943767 6:105444348-105444370 GCTCTTGTCTGCAGCTGATCTGG + Intergenic
1013392077 6:109695816-109695838 GCTCTTGTCTGCAGCTGATCTGG + Intronic
1013791397 6:113840825-113840847 GCTCATGAGCGATGATGATTGGG + Intergenic
1014677610 6:124386559-124386581 GCTCTTGTCTGCAGCTGATCCGG + Intronic
1015535871 6:134267125-134267147 GCTCTAGAGTGCGGGTGTTCAGG - Intronic
1016301950 6:142642477-142642499 GCTCTTGTCTGCAGCTGATCTGG - Intergenic
1017299480 6:152839347-152839369 GCTCTTGTCTGCAGCTGATCTGG + Intergenic
1017343356 6:153352636-153352658 GCTCTTGTCTGCAGTTGATCTGG - Intergenic
1018691542 6:166348531-166348553 GCTCTTGTCTGCAGCTGATCTGG - Intergenic
1018777409 6:167030525-167030547 CCTCCTGACTGCTTATGATCAGG + Intronic
1020455332 7:8366895-8366917 CATATTGAGTCCTGATGATCTGG - Intergenic
1020907420 7:14080670-14080692 GCTCTTGTCTGCAGCTGATCTGG + Intergenic
1021987304 7:26109272-26109294 GCTCTTGTCTGCAGCTGATCTGG - Intergenic
1031727943 7:125262429-125262451 GCTCTTGTGTGCTGGAGATGTGG + Intergenic
1033214849 7:139485815-139485837 GCTCTTGGCTGCAGCTGATCTGG - Intergenic
1034549832 7:151813410-151813432 GTCCTTGAGTGCTGGTGATTAGG - Intronic
1035259290 7:157651366-157651388 CCTCTTGAGTGTTGAAGATGAGG - Intronic
1036677290 8:10845245-10845267 GCTCTTGTCTGCAGCTGATCTGG + Intergenic
1037362952 8:18093018-18093040 ACTCTTGACTGCAGCTGATCTGG + Intergenic
1038853553 8:31305198-31305220 GCTCTTGTCTGCAGCTGATCTGG + Intergenic
1041917547 8:63151823-63151845 GTTCTTGTGTGCTGGAGATCTGG + Intergenic
1042064995 8:64864826-64864848 TCCCTTGAGTCCTGATGGTCTGG + Intergenic
1048122083 8:131592925-131592947 GCTCTTGTCTGCAGCTGATCTGG + Intergenic
1048314324 8:133350909-133350931 GCTGTTCAGTGCTGAGGGTCTGG - Intergenic
1052203756 9:25813271-25813293 TCTCTTAATTGCTGATGATCTGG - Intergenic
1056811470 9:89768302-89768324 GCTCTTATCTGCTGCTGATCTGG - Intergenic
1057292037 9:93812969-93812991 TCTCTTGAGTGCTGATGGCCTGG + Intergenic
1058026218 9:100144220-100144242 GTTCTTGTGTGCTGGTGATGTGG + Intronic
1059761138 9:117338829-117338851 GCTGTTGAGTTTTGATGACCAGG - Intronic
1186691678 X:11984494-11984516 GCTCTTGTCTGCAGCTGATCTGG + Intergenic
1187393401 X:18900669-18900691 GCGGTTTAGTGCTGATGAACAGG - Exonic
1188266025 X:28075805-28075827 GCCCTTGACTGCAGCTGATCTGG - Intergenic
1188407191 X:29826258-29826280 ACTCTTGAGTCCTGATGTTTTGG - Intronic
1189637027 X:43022364-43022386 GCTCTTGTCTGCAGCTGATCTGG + Intergenic
1190886442 X:54534553-54534575 GCTTTTGAGTACTGATGAATTGG + Intronic
1190908714 X:54752686-54752708 GCTCTTGTCTGCAGGTGATCTGG - Intronic
1192771685 X:74199215-74199237 GCTCTTGTCTGCAGCTGATCTGG - Intergenic
1192889339 X:75371969-75371991 GCTCTTTAGTGCTAATCCTCAGG + Exonic
1197282709 X:124555976-124555998 GCTTTTGTCTGCTGCTGATCTGG - Intronic
1199905116 X:152219297-152219319 ACTCCTGGGTGCTGATTATCTGG - Intronic
1201379253 Y:13355035-13355057 GCTCTTCTGTGCTGCTGTTCAGG + Exonic
1201473514 Y:14357921-14357943 GTTCTTGTGTGCTGAAGATGTGG + Intergenic