ID: 1077889811

View in Genome Browser
Species Human (GRCh38)
Location 11:6410923-6410945
Sequence TGAGTGCTGATGATCAGGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 131}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077889795_1077889811 30 Left 1077889795 11:6410870-6410892 CCTCCTCGGCCTCCCCGGCCGCC 0: 1
1: 1
2: 25
3: 203
4: 2127
Right 1077889811 11:6410923-6410945 TGAGTGCTGATGATCAGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 131
1077889803_1077889811 9 Left 1077889803 11:6410891-6410913 CCTTCTCCTCTCCCTCATCTGGC 0: 1
1: 1
2: 6
3: 80
4: 984
Right 1077889811 11:6410923-6410945 TGAGTGCTGATGATCAGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 131
1077889801_1077889811 12 Left 1077889801 11:6410888-6410910 CCGCCTTCTCCTCTCCCTCATCT 0: 1
1: 1
2: 54
3: 748
4: 4990
Right 1077889811 11:6410923-6410945 TGAGTGCTGATGATCAGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 131
1077889797_1077889811 21 Left 1077889797 11:6410879-6410901 CCTCCCCGGCCGCCTTCTCCTCT 0: 1
1: 0
2: 4
3: 100
4: 849
Right 1077889811 11:6410923-6410945 TGAGTGCTGATGATCAGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 131
1077889805_1077889811 -2 Left 1077889805 11:6410902-6410924 CCCTCATCTGGCCCCTGCTCTTG 0: 1
1: 0
2: 3
3: 36
4: 438
Right 1077889811 11:6410923-6410945 TGAGTGCTGATGATCAGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 131
1077889804_1077889811 3 Left 1077889804 11:6410897-6410919 CCTCTCCCTCATCTGGCCCCTGC 0: 1
1: 1
2: 12
3: 92
4: 712
Right 1077889811 11:6410923-6410945 TGAGTGCTGATGATCAGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 131
1077889800_1077889811 16 Left 1077889800 11:6410884-6410906 CCGGCCGCCTTCTCCTCTCCCTC 0: 1
1: 0
2: 17
3: 204
4: 1952
Right 1077889811 11:6410923-6410945 TGAGTGCTGATGATCAGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 131
1077889799_1077889811 17 Left 1077889799 11:6410883-6410905 CCCGGCCGCCTTCTCCTCTCCCT 0: 1
1: 0
2: 5
3: 93
4: 1019
Right 1077889811 11:6410923-6410945 TGAGTGCTGATGATCAGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 131
1077889796_1077889811 27 Left 1077889796 11:6410873-6410895 CCTCGGCCTCCCCGGCCGCCTTC 0: 1
1: 0
2: 10
3: 62
4: 612
Right 1077889811 11:6410923-6410945 TGAGTGCTGATGATCAGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 131
1077889798_1077889811 18 Left 1077889798 11:6410882-6410904 CCCCGGCCGCCTTCTCCTCTCCC 0: 1
1: 0
2: 8
3: 130
4: 993
Right 1077889811 11:6410923-6410945 TGAGTGCTGATGATCAGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 131
1077889806_1077889811 -3 Left 1077889806 11:6410903-6410925 CCTCATCTGGCCCCTGCTCTTGA 0: 1
1: 0
2: 1
3: 30
4: 373
Right 1077889811 11:6410923-6410945 TGAGTGCTGATGATCAGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077889811 Original CRISPR TGAGTGCTGATGATCAGGCC AGG Exonic
900102683 1:968679-968701 TGAGTGCAGAGGATCAGGGAAGG + Intronic
900862427 1:5243103-5243125 CGAGGGCTGGTGACCAGGCCAGG - Intergenic
901432900 1:9228518-9228540 TGAGGGCTGAGAATCAGCCCGGG + Intergenic
901466682 1:9426237-9426259 TAAGTCCTGATCATCAGCCCAGG + Intergenic
903808269 1:26020783-26020805 GGAGGGCTGCTGATCAGACCAGG - Intronic
904327420 1:29736306-29736328 TCAGTGCTGATGGTCTGGACAGG + Intergenic
905874670 1:41424182-41424204 TGAGTGGAGATGAGCAGCCCAGG + Intergenic
906439447 1:45828338-45828360 TGAGTGATCATGATAAAGCCAGG + Intronic
910338685 1:86161025-86161047 TAAATATTGATGATCAGGCCAGG - Intergenic
912572493 1:110634779-110634801 TAAGTGATGAAGAACAGGCCTGG - Intergenic
913085727 1:115434855-115434877 CGAGTGCTGGTGCCCAGGCCTGG - Intergenic
916818445 1:168375363-168375385 TGAGAGCTGATGATCAGAAATGG + Intergenic
919743682 1:200995356-200995378 TGAGGGCTGAGGATCAGAGCAGG + Intronic
1063451188 10:6151377-6151399 TGAGTGTTGAAGCCCAGGCCAGG - Intronic
1063699923 10:8374464-8374486 TGAGAGCGCAGGATCAGGCCAGG - Intergenic
1069543488 10:69312989-69313011 TGAGTGGAGATGAACAGGTCAGG + Intronic
1069748808 10:70732761-70732783 TGAGTGCTGAGTATCAGGGTGGG - Intronic
1071333464 10:84583466-84583488 TGAGCGCAGAGGCTCAGGCCTGG - Intergenic
1073399835 10:103248161-103248183 TGAGTGGTGATGTACAAGCCTGG + Intergenic
1075559118 10:123455813-123455835 TGAGTGATGCAGAGCAGGCCCGG + Intergenic
1075577457 10:123588417-123588439 TGAGAGCTGCTGGACAGGCCAGG + Intergenic
1076985412 11:232574-232596 TGTGTGCTGGTGATGAGGACAGG + Intronic
1077889811 11:6410923-6410945 TGAGTGCTGATGATCAGGCCAGG + Exonic
1079039257 11:17046974-17046996 TGAGTGCTGAGGGACAGGTCAGG + Intergenic
1080623897 11:34011195-34011217 TGAGTGCTCATGGCCAGGCGCGG - Intergenic
1081810743 11:45912917-45912939 TGAGGCATGAGGATCAGGCCAGG - Intronic
1084939902 11:72606968-72606990 TGGGTGCTGATGAGGAAGCCAGG + Intronic
1090559771 11:127919304-127919326 TGAGTGCTGATGATTAGTTGTGG + Intergenic
1091915500 12:4269851-4269873 GGAGTGCGGATGCACAGGCCTGG + Intergenic
1093667380 12:21830815-21830837 TGAGTGCTGCCATTCAGGCCAGG - Intronic
1097181473 12:57174395-57174417 TGACTGCTGATGGTCAGGGCAGG + Intronic
1101754146 12:107607822-107607844 TGAGTGATGAGGGACAGGCCAGG + Intronic
1102441137 12:112964706-112964728 TGAGTCCTGATGATGCTGCCTGG - Intronic
1102613640 12:114134231-114134253 TAGGTGCTGATCCTCAGGCCAGG + Intergenic
1102890811 12:116557431-116557453 TGAGACCCCATGATCAGGCCTGG + Intergenic
1105030906 12:132882995-132883017 AGAATGCTGATATTCAGGCCAGG - Intronic
1106027425 13:25968366-25968388 TGAGTGCTGCAGACCAGACCCGG - Intronic
1108449822 13:50549829-50549851 TGGGTCCTGCTGATCAGGCCTGG - Intronic
1110852224 13:80258790-80258812 CGAGTGTTGAAGATGAGGCCCGG - Intergenic
1113131033 13:107037212-107037234 TGAGTGCTGCAGCTCAGGCAAGG - Intergenic
1113795277 13:113053591-113053613 TGTGTGGTGATGCTCAGGACGGG + Intronic
1113959118 13:114116014-114116036 TGAGTGTGGATGTTGAGGCCTGG + Intronic
1114587261 14:23826238-23826260 TGAGAGCTGAGGATCAGCTCTGG + Intergenic
1117450388 14:55844463-55844485 TGAGTACTTGTGAACAGGCCTGG - Intergenic
1117920007 14:60719954-60719976 TCAGTGCTGGGTATCAGGCCTGG + Exonic
1119387370 14:74266049-74266071 CGGGTGCTGGTGAGCAGGCCTGG + Intergenic
1121762017 14:96453917-96453939 TGAGTCCTGACGAGCAGGGCTGG - Intronic
1123943052 15:25225824-25225846 TGAGAGTTGATGCTCAGGTCAGG + Intergenic
1124634170 15:31354257-31354279 GGTGTGCTGGTGAGCAGGCCTGG + Intronic
1125577232 15:40764184-40764206 TGGGTGCTGATGAGCAGGTAGGG - Exonic
1127994128 15:64142720-64142742 GGAGTGCTGAAGATGAGGACTGG + Intronic
1128121593 15:65152221-65152243 TGAAAGTTGATCATCAGGCCGGG - Intronic
1131811186 15:96174974-96174996 AGAATGCTGATGATTAGGACAGG + Intergenic
1133232009 16:4371442-4371464 TGAGTCCTCATGACCAGCCCGGG - Intronic
1134340878 16:13344670-13344692 TAAGTGCTTATCATCATGCCTGG - Intergenic
1135498900 16:22976707-22976729 TGAGTGATGTGGATCAGGCAGGG - Intergenic
1139670314 16:68488302-68488324 TGAGTGGGGATGATCAGGTCAGG + Intergenic
1140703345 16:77603017-77603039 TGCTTGCTGATGATCAGGTGGGG + Intergenic
1141431744 16:83973711-83973733 TGTGTGCTGGGTATCAGGCCCGG - Intronic
1147896834 17:43756805-43756827 TGTGTGCAGGGGATCAGGCCAGG - Intronic
1148570435 17:48664023-48664045 AGAGTTCTGATGCACAGGCCAGG + Intergenic
1155944315 18:31830762-31830784 TTACTGATGATGATCAGGGCAGG + Exonic
1161328181 19:3673286-3673308 TGAGGGGTGATGTTCAAGCCAGG - Intronic
1161946336 19:7439663-7439685 CGAGTGCTGATGACCAGGGGCGG + Intronic
1163237973 19:16040312-16040334 TGAATGATGATGTTGAGGCCAGG + Intergenic
928204397 2:29273681-29273703 TCAGTGCTGTTGATTAGGCTGGG + Intronic
928444912 2:31325411-31325433 TGAGTGCAGGTTACCAGGCCAGG - Intergenic
930093141 2:47546135-47546157 TGAGTCCCAATGATCAGGCTTGG + Intronic
932454899 2:71843357-71843379 TGAGTGCTGATGGGCAGGAAGGG - Intergenic
934696580 2:96404706-96404728 TGAGTGCTGATGAGCAGGGGAGG - Intergenic
938039474 2:128063841-128063863 TGGGTACTGATGGTGAGGCCAGG - Intergenic
941433038 2:165435024-165435046 TGAGAGCTGTTTATCAGGCACGG + Intergenic
943668821 2:190638716-190638738 TGAGTGGAGATGATCAAGGCAGG + Intergenic
1172478544 20:35256900-35256922 TTGGTTCTTATGATCAGGCCAGG - Intronic
1175599449 20:60260894-60260916 AGAGTGCTGATGACAGGGCCTGG + Intergenic
1177345164 21:19857446-19857468 TGATTGCTTATGGTTAGGCCTGG + Intergenic
1177443928 21:21166499-21166521 TAAGTCTTGATGACCAGGCCAGG - Intronic
1180672493 22:17564245-17564267 TGAGTGAGAATGATCAGGGCAGG - Intronic
1181112710 22:20611398-20611420 TGAGAGCTGAGGATGAGGACAGG + Intergenic
1184099985 22:42336895-42336917 TGTGTGGTGATGATCAGGGTGGG - Intronic
950804081 3:15581837-15581859 TGAATGCTTATGATAAGGCAGGG - Intronic
952952189 3:38533851-38533873 TGACTGCTGATGCTGGGGCCTGG + Intronic
953158710 3:40398394-40398416 GGAGTGGTGGTGATCAGGTCAGG + Intronic
954073445 3:48159612-48159634 TGAGTGCTGCTCATGTGGCCAGG - Intronic
957034557 3:75281795-75281817 GGAATGCTACTGATCAGGCCTGG - Intergenic
958892501 3:99796011-99796033 GCAGTGCTGCTGCTCAGGCCCGG + Exonic
960427228 3:117523681-117523703 TAAGTGGTGATGCTCAGGACTGG - Intergenic
961173328 3:124814734-124814756 TGAGTGATTATGACCAGGCGTGG - Intronic
964162213 3:153659229-153659251 AAAGAGCTGATAATCAGGCCAGG + Intergenic
964339456 3:155693067-155693089 AAAATGCTGATGATTAGGCCGGG - Intronic
966608910 3:181849064-181849086 ATAGTGCTGAATATCAGGCCAGG + Intergenic
968892195 4:3375359-3375381 TGAGGGCTGAAGATGAGGGCTGG - Intronic
969317433 4:6390598-6390620 TCAGTGCTGATGTCCAGTCCCGG - Intronic
969488500 4:7485681-7485703 TGGGAGCTGAGGCTCAGGCCTGG + Intronic
971899199 4:32636363-32636385 TGAGTGGTGATGAACTGGTCGGG - Intergenic
972277148 4:37568090-37568112 GGAATGCTGAGGAACAGGCCAGG - Intronic
975198343 4:71553416-71553438 TGAGGGATGAGGATGAGGCCAGG + Intronic
982128457 4:152205036-152205058 TGAGTGCTGATGTTTTTGCCAGG + Intergenic
983413318 4:167424825-167424847 GGAGCGCTGATGGTCAGGCGTGG - Intergenic
983593695 4:169442052-169442074 TGAGTGCTGATGATGGACCCAGG + Intronic
988451724 5:31350682-31350704 AGAGTGCTGAAGATGAGGCCTGG - Intergenic
989425456 5:41290925-41290947 TGAGTGCTGATGAGCATGGGAGG - Intergenic
990634649 5:57711095-57711117 TGAGTGCTGAGAAACAGGACTGG + Intergenic
990645161 5:57835411-57835433 AGAGTGCTGTGGATCATGCCTGG - Intergenic
992069213 5:73134702-73134724 TGTGTGCTGATGATAATGTCTGG - Intergenic
1000703607 5:164483716-164483738 GTAATTCTGATGATCAGGCCAGG - Intergenic
1000752580 5:165114966-165114988 AATGTACTGATGATCAGGCCGGG - Intergenic
1001674891 5:173503824-173503846 TGAGTGCTGGAGGTCAGGCAGGG + Intergenic
1003115358 6:3280345-3280367 AGGGTGCTGATGATATGGCCCGG - Intronic
1007250101 6:40489624-40489646 TGGGTGCTGACGAGGAGGCCTGG + Intronic
1011151526 6:84278837-84278859 GGAGTACTTATGTTCAGGCCAGG + Intergenic
1011851672 6:91636892-91636914 TGAGTACTTAGGGTCAGGCCAGG + Intergenic
1014825455 6:126044888-126044910 AAAATGCTGATTATCAGGCCAGG + Intergenic
1014933979 6:127365201-127365223 TAGGTGCTGTTCATCAGGCCAGG + Intergenic
1021009430 7:15443169-15443191 TCTGTGCTTATGATGAGGCCGGG + Intronic
1024355074 7:48406161-48406183 TGAGGGCTCTTGATCAGCCCTGG + Intronic
1029636719 7:101789468-101789490 CGTGTGCGGATGCTCAGGCCTGG + Intergenic
1030429751 7:109430063-109430085 AGAGTGCTGCTTACCAGGCCAGG + Intergenic
1037168356 8:15858682-15858704 TGAGTGCTGAAGAGCAGGGGAGG - Intergenic
1038736563 8:30174911-30174933 TGACTACTGATGATAAAGCCTGG + Intronic
1041365195 8:57095001-57095023 TGAGTGCAGATGAGGAGGCGGGG + Intergenic
1042206817 8:66337856-66337878 TTCTTGCTGAAGATCAGGCCAGG - Intergenic
1042420686 8:68585101-68585123 TGAATGCTGATGCTCAGCACTGG + Intronic
1042974149 8:74446409-74446431 TGGGTGCTGGAGACCAGGCCAGG + Intronic
1044909920 8:97045966-97045988 TAAGGGCTGAAGATCAGGCAGGG + Intronic
1045506888 8:102785108-102785130 TGAGTGCTGCTGATGCTGCCAGG + Intergenic
1047471838 8:125181772-125181794 TGGGTGGTGATGCTCAGGTCTGG + Intronic
1047978652 8:130157430-130157452 TGGGAGCTGATGATGAGGCCAGG - Intronic
1057338766 9:94180465-94180487 TTACTGCTCATGATCAGGCAAGG - Intergenic
1057736221 9:97663881-97663903 TAAGACCTAATGATCAGGCCAGG + Intronic
1058776693 9:108291224-108291246 TGAGAGCTGATTACCATGCCCGG - Intergenic
1059824852 9:118017335-118017357 TGGGTGCTGAGGGTCAGTCCTGG + Intergenic
1060681705 9:125571559-125571581 TAAATGCTGCTGATCCGGCCAGG + Intronic
1062009688 9:134260309-134260331 TGAGTGATGCTGATCAGCCACGG + Intergenic
1187096358 X:16152514-16152536 TGAGACCGGATGATCAGGCCAGG - Exonic
1187128898 X:16481847-16481869 TGTGTGCTGAAGAACAGGCAGGG - Intergenic
1195702838 X:107717572-107717594 TGAGTGCTGGGGTTCAGGGCAGG - Intronic
1195822896 X:108966458-108966480 TGAGTAATGATGGTCAGGCTGGG - Intergenic
1200698275 Y:6380408-6380430 TGAGAGCTCATCATCAGGCCAGG + Intergenic
1200913505 Y:8551343-8551365 CCAGAGCTCATGATCAGGCCTGG - Intergenic
1201035839 Y:9784291-9784313 TGAGAGCTCATCATCAGGCCAGG - Intergenic