ID: 1077889812

View in Genome Browser
Species Human (GRCh38)
Location 11:6410933-6410955
Sequence TGATCAGGCCAGGTCCTCGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077889799_1077889812 27 Left 1077889799 11:6410883-6410905 CCCGGCCGCCTTCTCCTCTCCCT 0: 1
1: 0
2: 5
3: 93
4: 1019
Right 1077889812 11:6410933-6410955 TGATCAGGCCAGGTCCTCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 77
1077889809_1077889812 -5 Left 1077889809 11:6410915-6410937 CCTGCTCTTGAGTGCTGATGATC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1077889812 11:6410933-6410955 TGATCAGGCCAGGTCCTCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 77
1077889805_1077889812 8 Left 1077889805 11:6410902-6410924 CCCTCATCTGGCCCCTGCTCTTG 0: 1
1: 0
2: 3
3: 36
4: 438
Right 1077889812 11:6410933-6410955 TGATCAGGCCAGGTCCTCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 77
1077889800_1077889812 26 Left 1077889800 11:6410884-6410906 CCGGCCGCCTTCTCCTCTCCCTC 0: 1
1: 0
2: 17
3: 204
4: 1952
Right 1077889812 11:6410933-6410955 TGATCAGGCCAGGTCCTCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 77
1077889807_1077889812 -3 Left 1077889807 11:6410913-6410935 CCCCTGCTCTTGAGTGCTGATGA 0: 1
1: 0
2: 0
3: 12
4: 210
Right 1077889812 11:6410933-6410955 TGATCAGGCCAGGTCCTCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 77
1077889801_1077889812 22 Left 1077889801 11:6410888-6410910 CCGCCTTCTCCTCTCCCTCATCT 0: 1
1: 1
2: 54
3: 748
4: 4990
Right 1077889812 11:6410933-6410955 TGATCAGGCCAGGTCCTCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 77
1077889808_1077889812 -4 Left 1077889808 11:6410914-6410936 CCCTGCTCTTGAGTGCTGATGAT 0: 1
1: 0
2: 1
3: 15
4: 154
Right 1077889812 11:6410933-6410955 TGATCAGGCCAGGTCCTCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 77
1077889798_1077889812 28 Left 1077889798 11:6410882-6410904 CCCCGGCCGCCTTCTCCTCTCCC 0: 1
1: 0
2: 8
3: 130
4: 993
Right 1077889812 11:6410933-6410955 TGATCAGGCCAGGTCCTCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 77
1077889804_1077889812 13 Left 1077889804 11:6410897-6410919 CCTCTCCCTCATCTGGCCCCTGC 0: 1
1: 1
2: 12
3: 92
4: 712
Right 1077889812 11:6410933-6410955 TGATCAGGCCAGGTCCTCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 77
1077889806_1077889812 7 Left 1077889806 11:6410903-6410925 CCTCATCTGGCCCCTGCTCTTGA 0: 1
1: 0
2: 1
3: 30
4: 373
Right 1077889812 11:6410933-6410955 TGATCAGGCCAGGTCCTCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 77
1077889803_1077889812 19 Left 1077889803 11:6410891-6410913 CCTTCTCCTCTCCCTCATCTGGC 0: 1
1: 1
2: 6
3: 80
4: 984
Right 1077889812 11:6410933-6410955 TGATCAGGCCAGGTCCTCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077889812 Original CRISPR TGATCAGGCCAGGTCCTCGT AGG Exonic
901210909 1:7525588-7525610 TCATCAGGCCAGCTCCTGGGAGG + Intronic
902396318 1:16134000-16134022 TGAGCACCCCAGGTCCTCCTAGG - Intronic
903673790 1:25052040-25052062 TGATCTGGCCAGGACCCCCTCGG + Intergenic
909789585 1:79658834-79658856 TGAACAGGCCATGTCATCTTTGG + Intergenic
912104187 1:106250025-106250047 TGATTAGGCCAGGTCCACCCAGG + Intergenic
912556092 1:110517232-110517254 TGATCAGTCCAGGGCTTCTTGGG - Exonic
919986937 1:202681983-202682005 TGATGAGGCCAGGGCCACGGTGG + Intronic
920968422 1:210721300-210721322 TTATCAGGCTAGCTCCTCGTAGG - Intronic
922566520 1:226605069-226605091 TGAGAAGGCCAGGTCCCCATGGG + Exonic
923036511 1:230288390-230288412 TGAGCAGGGCTGGTCCTGGTTGG - Intergenic
1065767884 10:29048618-29048640 TGATCTGGCCAGATTCTCATTGG - Intergenic
1067090544 10:43264059-43264081 TGAGCAGGCCAGGACCCCGAGGG + Intronic
1067736178 10:48852718-48852740 TGTTCAGGCCAGGAGCTTGTAGG - Intronic
1072718395 10:97766422-97766444 TGATCAGGCCCTGACCTCCTCGG + Intergenic
1075289627 10:121217216-121217238 TGTTCAGGCCAGGACCTGGCAGG - Intergenic
1076378882 10:130011550-130011572 TAATGAGGGCAGGTCCTCGAAGG + Intergenic
1077061165 11:618499-618521 TGGTCAGGCCAGGTCAGCCTGGG + Intronic
1077889812 11:6410933-6410955 TGATCAGGCCAGGTCCTCGTAGG + Exonic
1084549521 11:69832827-69832849 GGCTCAGGCCAGCTCCTGGTCGG + Intergenic
1093743645 12:22715448-22715470 TGATTAGGTCAGGCCCTCCTAGG - Intergenic
1101440352 12:104699866-104699888 TGATGAGGCCAGCACCTCCTGGG + Intronic
1101881737 12:108630334-108630356 TGCTCAGGAAAGATCCTCGTGGG + Intronic
1113596140 13:111534844-111534866 TGATGTGTCCAGGTCCTGGTAGG + Intergenic
1113682519 13:112254286-112254308 TCATCGGGCCAGTTCCTCCTGGG + Intergenic
1120883432 14:89432966-89432988 TATGCAGGCCAGGTGCTCGTTGG - Intronic
1121587672 14:95074149-95074171 TGATTAGGCCAGGCCCACTTAGG - Intergenic
1130375465 15:83325138-83325160 TGATCAGGGAAGCTCCTCCTAGG - Intergenic
1132802082 16:1759449-1759471 AGATCAGTCCAGGTCCACTTGGG + Intronic
1133912961 16:10082562-10082584 TGATGAGGCCAGGCCCACCTTGG - Intronic
1140768727 16:78183771-78183793 TGAGGAGGCCAGTCCCTCGTGGG - Intronic
1144773299 17:17771320-17771342 TGCTCAGGCCAGGGGCTCATGGG - Intronic
1161593198 19:5137907-5137929 TGACCAGCCCAGGTCCTCAGAGG + Intronic
1161850451 19:6735541-6735563 TGATCAGCCCAGGTGCGTGTGGG + Intronic
1163664066 19:18594888-18594910 TGATCAGGCCCTTTCCTCCTGGG - Intronic
1165071919 19:33260790-33260812 GGAGCAGGCCAGGCCCTCCTGGG + Intergenic
1165445881 19:35856600-35856622 TGCTCAGCCCAGGTCCTAGAGGG - Intronic
1168071305 19:53953623-53953645 TGATTAGGCCAGGCCCACCTGGG + Intergenic
926226432 2:10970450-10970472 TGGTCAGGGCAGGCCCTCCTGGG + Intergenic
928095795 2:28404292-28404314 TGATCACGCCAGGTCTTGGGAGG - Exonic
930053917 2:47237563-47237585 TGATGAGGACAGGCCCTGGTTGG + Intergenic
937989615 2:127654946-127654968 TGAGCAGCCCAGGCCCTTGTTGG + Intronic
938621832 2:133063466-133063488 TGATCTGGTCAGGCCCTCCTTGG - Intronic
938769694 2:134490544-134490566 TGATCATCCCAGGCCCTTGTGGG - Intronic
945736724 2:213609966-213609988 TAGTCAGGCCAGGTCATGGTTGG + Intronic
947229106 2:227867472-227867494 TGTTCAAGGCAGGTCCTGGTGGG + Intergenic
948879964 2:240851593-240851615 TGATCTGGGCAGAGCCTCGTGGG + Intergenic
1170976058 20:21165794-21165816 TGATTAGGTCAGGTCCACCTTGG - Intronic
1172198820 20:33111249-33111271 TGACCTGGCCAGGTGCTCCTCGG + Intronic
1173317400 20:41957452-41957474 TGATCAGGCCACATCCTCTATGG + Intergenic
1173790918 20:45827305-45827327 AGAGCAGGCCAGGTCATCTTTGG - Exonic
1174393334 20:50231565-50231587 TGTCCAGGCCAGGTCCTCCCTGG - Intergenic
1180021827 21:45133428-45133450 TGATCAGGCCAGGCCCACCCAGG + Intronic
1180219653 21:46350484-46350506 TGATGTGGCCAGGTCCTCATTGG + Intronic
1184814713 22:46860794-46860816 TGAGCAGGACAGGTCCTCTCGGG + Intronic
951896504 3:27614661-27614683 TGATCAGGCAAGGCCCGGGTGGG - Intergenic
952270539 3:31826782-31826804 TGATGTGGCCAGGTCCACCTTGG - Intronic
959429074 3:106229698-106229720 TGATTAGGCCAGGCCCACCTAGG - Intergenic
961862201 3:129926041-129926063 TGATCAGGCCAGCTCCTGCAGGG + Intergenic
966191143 3:177272604-177272626 TGATTAAGCCAGGTCCTCCCAGG - Intergenic
984833408 4:183997519-183997541 AGAGCAGGCAAGGTCCTCTTAGG - Intronic
986411589 5:7486911-7486933 TGATAAGGCCAGTTCCTGGAAGG + Intronic
986744155 5:10729891-10729913 TGTGCAGGCAGGGTCCTCGTGGG - Intronic
987226546 5:15847709-15847731 TGATTAGGTCAGGTCCTCCTTGG - Intronic
990494875 5:56337380-56337402 TTATCAGGCCAGCTCCTACTTGG - Intergenic
998006235 5:138658874-138658896 TGATTAGGCCAGGTCAGCGAGGG + Intronic
1001441870 5:171749742-171749764 GGCTCAGGCCAGAGCCTCGTGGG - Intergenic
1003541748 6:7024323-7024345 TGATGAGGCCAGATCCACCTAGG + Intergenic
1003902749 6:10670046-10670068 TGATCAAGCCAGGGCCCTGTAGG + Intergenic
1004911749 6:20292495-20292517 TGCTCTGGCCACGTCCTAGTTGG - Intergenic
1006153468 6:32001605-32001627 GGGTCAGGCCAGGGCCTCGGTGG - Intronic
1006159776 6:32034342-32034364 GGGTCAGGCCAGGGCCTCGGTGG - Intronic
1017581553 6:155870347-155870369 TGATCAAGCTGTGTCCTCGTTGG + Intergenic
1020463293 7:8447970-8447992 TGTTATGGCCAGGTCCTCGTTGG - Intronic
1024458166 7:49632275-49632297 TCATCAGGCCCGCTCCTCCTTGG - Intergenic
1039255617 8:35715753-35715775 GAATGAGGCCAGGTCCTCATGGG + Intronic
1046022103 8:108677819-108677841 GGATCAGCCCAGGTCTTCCTAGG + Intronic
1047655110 8:126968986-126969008 TGAGCAGGCCAGGTCCTAAATGG - Intergenic
1051167550 9:14280432-14280454 TGATTAGGATAGGTCCTCCTTGG - Intronic
1057796615 9:98162292-98162314 TGATCATGACAGTTCCTCTTAGG - Intronic
1060745705 9:126129467-126129489 TGGTCAGGGCAGGTCTTTGTTGG - Intergenic
1061895839 9:133647066-133647088 TGCACAGGCCAGGTCCTGCTTGG - Intronic
1199411562 X:147529444-147529466 TGAAAAGCCTAGGTCCTCGTAGG - Intergenic