ID: 1077892019

View in Genome Browser
Species Human (GRCh38)
Location 11:6425690-6425712
Sequence TATTACCAATAAAAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077892019_1077892024 -4 Left 1077892019 11:6425690-6425712 CCTTCCCCCTTTTATTGGTAATA No data
Right 1077892024 11:6425709-6425731 AATAGCACATCTGTTTTCTTTGG No data
1077892019_1077892028 30 Left 1077892019 11:6425690-6425712 CCTTCCCCCTTTTATTGGTAATA No data
Right 1077892028 11:6425743-6425765 CTCCCCACTCTTTGTCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077892019 Original CRISPR TATTACCAATAAAAGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr