ID: 1077892605

View in Genome Browser
Species Human (GRCh38)
Location 11:6430349-6430371
Sequence AGCAAATGTCACTGGCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077892605_1077892613 14 Left 1077892605 11:6430349-6430371 CCTCCTTGCCAGTGACATTTGCT No data
Right 1077892613 11:6430386-6430408 AGATACCCAGGAGGCTAATTGGG No data
1077892605_1077892614 18 Left 1077892605 11:6430349-6430371 CCTCCTTGCCAGTGACATTTGCT No data
Right 1077892614 11:6430390-6430412 ACCCAGGAGGCTAATTGGGTAGG No data
1077892605_1077892612 13 Left 1077892605 11:6430349-6430371 CCTCCTTGCCAGTGACATTTGCT No data
Right 1077892612 11:6430385-6430407 CAGATACCCAGGAGGCTAATTGG No data
1077892605_1077892611 5 Left 1077892605 11:6430349-6430371 CCTCCTTGCCAGTGACATTTGCT No data
Right 1077892611 11:6430377-6430399 AGATGGTGCAGATACCCAGGAGG No data
1077892605_1077892610 2 Left 1077892605 11:6430349-6430371 CCTCCTTGCCAGTGACATTTGCT No data
Right 1077892610 11:6430374-6430396 TCTAGATGGTGCAGATACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077892605 Original CRISPR AGCAAATGTCACTGGCAAGG AGG (reversed) Intergenic
No off target data available for this crispr