ID: 1077892954

View in Genome Browser
Species Human (GRCh38)
Location 11:6432432-6432454
Sequence ATGAGGTGGTGGAAGAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 638
Summary {0: 1, 1: 0, 2: 6, 3: 50, 4: 581}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077892945_1077892954 27 Left 1077892945 11:6432382-6432404 CCACTTCTACTGAATGTTCTCAC 0: 1
1: 0
2: 1
3: 13
4: 178
Right 1077892954 11:6432432-6432454 ATGAGGTGGTGGAAGAGTGAGGG 0: 1
1: 0
2: 6
3: 50
4: 581
1077892949_1077892954 -10 Left 1077892949 11:6432419-6432441 CCAGTCTCTCCCTATGAGGTGGT 0: 1
1: 0
2: 1
3: 10
4: 126
Right 1077892954 11:6432432-6432454 ATGAGGTGGTGGAAGAGTGAGGG 0: 1
1: 0
2: 6
3: 50
4: 581

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077892954 Original CRISPR ATGAGGTGGTGGAAGAGTGA GGG Intronic
900545166 1:3224681-3224703 ATGATGAGGTGGAGGAATGAGGG + Intronic
900574559 1:3376720-3376742 TTGGGGTGGGGGAAGAGTGAGGG - Intronic
900599453 1:3496876-3496898 CTGAGGGGGTGGAAGATGGAGGG - Intronic
900831821 1:4970977-4970999 ATTAGGTGGTGGCACAGTGCTGG + Intergenic
901313492 1:8288803-8288825 ATGAGGTGGAGGCAGATGGATGG - Intergenic
901318130 1:8322545-8322567 GTGGGGTGGTGGAAGAGTTTTGG + Intronic
901470536 1:9453078-9453100 ATGTGGTGGAGGAAGATTTATGG - Intergenic
901492334 1:9602857-9602879 AGGAGGTGGTGGAGCCGTGAAGG + Intronic
902758571 1:18565988-18566010 ATGAGGTATTGGGAGAGTGTGGG + Intergenic
902950256 1:19877111-19877133 ATGAGGTGGTGGATAGATGACGG - Intergenic
903298198 1:22359285-22359307 AAGAGATGGAGCAAGAGTGAGGG - Intergenic
903605051 1:24569362-24569384 GTGAGTGGGTGGGAGAGTGAAGG - Intronic
905499301 1:38424228-38424250 ATGAGGTGGGGGACGGGGGAGGG - Intergenic
905949922 1:41941484-41941506 ATTTGGTGGTGGAAGTATGAGGG + Intronic
906046676 1:42836402-42836424 TTGAGGAGGTGCAGGAGTGAGGG + Intronic
906192005 1:43904883-43904905 AGGAGGGGGAGGAAGAGTGGCGG - Intronic
906192032 1:43904980-43905002 AGGAGGAGGGGGAAGAGTGGTGG - Intronic
906192099 1:43905225-43905247 AGGAGGGGGAGGAAGAGTGGCGG - Intronic
906192130 1:43905339-43905361 AGGAGGAGGGGGAAGAGTGGTGG - Intronic
906192232 1:43905702-43905724 AGGAGGGGGAGGAAGAGTGGTGG - Intronic
906192286 1:43905919-43905941 AGGAGGAGGGGGAAGAGTGGTGG - Intronic
906192309 1:43905990-43906012 AGGAGGAGGGGGAAGAGTGGCGG - Intronic
906192429 1:43906425-43906447 AGGAGGAGGGGGAAGAGTGGTGG - Intronic
906192452 1:43906496-43906518 AGGAGGAGGGGGAAGAGTGGCGG - Intronic
906192468 1:43906559-43906581 AGGAGGAGGAGGAAGAGTGGCGG - Intronic
906287797 1:44598943-44598965 ATGGGGTGGGGGAAGTGTGAGGG - Intronic
906569584 1:46825279-46825301 ATGAGGTGGGGGAAGGGAGGAGG - Intergenic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907864598 1:58387497-58387519 GGGAGGTGGTGGGAAAGTGAAGG + Intronic
908595194 1:65681097-65681119 AAGAGGAGGTGGATGTGTGATGG + Intergenic
909760458 1:79279770-79279792 ATGGGGTGGAGGAGGAGGGAAGG + Intergenic
910324192 1:85985734-85985756 ATGAGGTCATTGAAGAGTCAGGG + Intronic
910611633 1:89150199-89150221 ATGAGGTGTGGGATAAGTGAAGG - Intronic
910851505 1:91653815-91653837 ATCTGGTGTTGGAAGAGTAAGGG + Intergenic
911249127 1:95555193-95555215 ATGAGGTCATGGAAGAGTCTTGG + Intergenic
911507985 1:98777378-98777400 ATGAGGGAGGGGAAGAGTGCTGG + Intergenic
912874778 1:113346651-113346673 ATGGGGTGGGGGAGGAGGGAAGG + Intergenic
913540806 1:119819022-119819044 ATGGGGTGGGGGAAGAGGGGAGG - Intergenic
914328620 1:146645548-146645570 GTGAGGTGGGGGGAGAGGGAGGG - Intergenic
914953326 1:152138773-152138795 ATGAGGTGGGGGAATAGGGGAGG - Intergenic
915222074 1:154383023-154383045 TTGAGGGGGTGGAAGGGTGGGGG + Intergenic
915305965 1:154978710-154978732 GTGAGGTTCTGAAAGAGTGAGGG - Exonic
915722875 1:157996726-157996748 CTGAGGTTGGGGAAGAGTCAGGG + Intronic
915916039 1:159941661-159941683 AAGGGGAGGTGGAAGAGGGAGGG - Intronic
917192010 1:172428040-172428062 CTGAGGTGGGGGCAGAGGGATGG - Intronic
917193544 1:172443845-172443867 ATGGGGTGCCAGAAGAGTGAAGG - Exonic
918018844 1:180664803-180664825 ATGGGGTGGAGGAAGAGAAATGG + Intronic
919807344 1:201388028-201388050 ATGAGGTGGGGGAAGAGCCTGGG - Intronic
919935764 1:202249682-202249704 ATGCAGTGGTGAAAGAGTTAAGG - Intronic
920460415 1:206135339-206135361 ATGAGGTAGGGGAGGAGAGAAGG + Intergenic
920551999 1:206869799-206869821 GTGAGGTGGGGGAAGAAGGAAGG - Intergenic
921185658 1:212667375-212667397 ATGAAGTGTTGGAGGTGTGAGGG + Intergenic
921269554 1:213455221-213455243 AGGAGGTGGAGGGAGAGTGTTGG + Intergenic
921717916 1:218437269-218437291 GTGAGGTGGTGGTAGAGTGAGGG + Intronic
921849256 1:219917454-219917476 AGCAGGTGGTGGGAGAGGGAAGG - Intronic
922799538 1:228358924-228358946 ATGGGATGGGGGAGGAGTGACGG - Intronic
922800633 1:228363170-228363192 AGGAGGAGGTGGAGGAGGGAGGG + Intronic
923045816 1:230354940-230354962 AGGAAGAGGTGGAAAAGTGAAGG + Intronic
923212479 1:231816931-231816953 AGGAGGAGGTGAAAGAGGGAGGG - Intronic
923482517 1:234397600-234397622 AGGAGGTGGGGGAAGAGGGGAGG + Intronic
923482526 1:234397620-234397642 AGGAGGTGGGGGAAGAGGGGAGG + Intronic
923637584 1:235715586-235715608 ATGAGGGAATGAAAGAGTGAAGG - Intronic
923693989 1:236228249-236228271 ATGAGGTAGGGGATAAGTGAGGG + Intronic
923776574 1:236983898-236983920 AGGAGGTGGGGGAAGAGGGAGGG + Intergenic
1063140622 10:3253894-3253916 ATGAGTGGGTGGATGAGTGGAGG - Intergenic
1063140652 10:3254010-3254032 ATGAGTGGGTGGATGAGTGGAGG - Intergenic
1063140681 10:3254126-3254148 ATGAGTGGGTGGATGAGTGGAGG - Intergenic
1063140708 10:3254242-3254264 ATGAGTGGGTGGATGAGTGGAGG - Intergenic
1063657496 10:8006759-8006781 ATGAGGAAGTGGAACCGTGAAGG + Intronic
1064203846 10:13306178-13306200 AGCAGGTGCAGGAAGAGTGAGGG + Intergenic
1064235175 10:13567315-13567337 AAGAGATGGTGGAAGGGTAAGGG - Intergenic
1064247591 10:13681485-13681507 ATGAGTTGGTGTAGGAGTCAAGG + Intronic
1064389314 10:14927776-14927798 ATGAGATGGTTGGAGACTGAAGG - Intronic
1064793828 10:18989271-18989293 ATGGGGTGGGGGAAGAGGGGAGG - Intergenic
1066517320 10:36177455-36177477 ATGAGGAGGAGGGAGGGTGAAGG - Intergenic
1068727626 10:60320830-60320852 ATGGGGTGGTGGAGAAGGGAGGG - Intronic
1068855313 10:61791834-61791856 AGGAGATGGTGATAGAGTGAAGG - Intergenic
1068876087 10:61998424-61998446 ATGGGGTGGTTGCGGAGTGATGG + Intronic
1069581858 10:69572116-69572138 ATGGGGTGGTGGCAGAGAGGAGG + Exonic
1069606204 10:69740299-69740321 AGGAGGTGGGGGAAGAGTCTTGG - Intergenic
1069809389 10:71147154-71147176 TTGAGGTGGTAGAAAAGAGAAGG + Intergenic
1069979452 10:72242190-72242212 ATGCTGTGGGGGAAGAGTGAGGG + Intergenic
1070684614 10:78471538-78471560 AGGAGGTGGTGGAGGTGTGGGGG + Intergenic
1070793211 10:79201991-79202013 GGGAGGTGGTGGGAGAGAGATGG - Intronic
1070895969 10:79983124-79983146 AGGAGGAGGTGGAAGAGTCCGGG - Intergenic
1071124752 10:82320918-82320940 ATGAGGAGCTGGAAAGGTGATGG - Intronic
1071602795 10:86967070-86967092 ATTAGGTGGAGGAAGGGGGAGGG - Intronic
1071852342 10:89586780-89586802 CAGAGGAGGTGGAAGAGAGAAGG + Intronic
1072312587 10:94170968-94170990 ATGAGGTGGGGGTGGAGTGGCGG - Intronic
1072738231 10:97893745-97893767 TAGAGATGGTGGAAGAGAGAGGG - Intronic
1073112284 10:101069924-101069946 ATGGGGTGGTGGGATAGAGAAGG + Intergenic
1074299120 10:112217154-112217176 ATGAGGTGTTGGCAGAGTTGCGG - Intergenic
1074440382 10:113472454-113472476 GAGAGATGGTGAAAGAGTGAGGG - Intergenic
1075510987 10:123072984-123073006 ATGAGGAATGGGAAGAGTGATGG - Intergenic
1076061603 10:127417874-127417896 ATCATGTGAAGGAAGAGTGATGG - Intronic
1076318824 10:129563987-129564009 CAGAGGTGGTGGAACAGTGGTGG + Intronic
1076379049 10:130012554-130012576 ATGAGGTGGGGGAGGTGGGAGGG + Intergenic
1076863499 10:133155135-133155157 AGGAGGTGGGGGAAGAGGCAAGG + Intergenic
1077649688 11:3958996-3959018 ATGAGGTGAGGGAGGAGTAAGGG - Intronic
1077730108 11:4721440-4721462 CTGAAGTGGTGGAGGAGAGAGGG - Intronic
1077892954 11:6432432-6432454 ATGAGGTGGTGGAAGAGTGAGGG + Intronic
1078541760 11:12218568-12218590 GTGAGATGGGGGAAGAGAGAAGG - Intronic
1078727001 11:13940582-13940604 ATGGGGCAGTGGAAGAGTGAGGG - Intergenic
1079135710 11:17775062-17775084 GTGAGTTTGTGGGAGAGTGAGGG + Intronic
1079362324 11:19779226-19779248 ATGAGGTGGAGGAAGGGCTAGGG + Intronic
1079393274 11:20040553-20040575 ATGATGTGGGGGAAGAGTGTGGG - Intronic
1079447211 11:20568495-20568517 AAGAGGTGGAGGGATAGTGAGGG - Intergenic
1080256405 11:30295507-30295529 CTGTGATGGTGGGAGAGTGAGGG - Intergenic
1080316448 11:30955591-30955613 AGGTGGTGGTGAAAGGGTGATGG - Intronic
1081190839 11:40101403-40101425 AAGAAGTGGTGGAAGAATGGTGG + Intergenic
1081312586 11:41592129-41592151 ATGAGGAGCTGGAAGGGGGATGG + Intergenic
1082097034 11:48139363-48139385 GTGATGTGGTGGAAGAGGCAGGG - Intronic
1082757912 11:57096390-57096412 GTGGGGTGGTGGAGGAGAGATGG + Intergenic
1083115770 11:60457808-60457830 AGGAGGTGGGGGAAGAGAGTGGG + Intronic
1083996826 11:66277023-66277045 AGGAGGTGCTAGCAGAGTGAGGG - Exonic
1084957533 11:72699236-72699258 AAGAGGTGGTGGAAAAGTCTTGG + Intronic
1085122292 11:73974887-73974909 AAGAGGTGGGGAAAGAGGGAAGG + Exonic
1086052296 11:82607579-82607601 AAGAGGTGGGGGAAGAAAGATGG - Intergenic
1086308701 11:85511221-85511243 GTGGGGTGGGGGAAGAGGGAAGG + Intronic
1086932235 11:92705605-92705627 ATGTGGTGGTGGTGGTGTGATGG + Intronic
1087158930 11:94930342-94930364 ATGGGGAGGTGGGAGAATGAAGG + Intergenic
1087182800 11:95156365-95156387 ATGAGCTGGTGGAGGAGAGATGG - Intergenic
1088294852 11:108281653-108281675 CTGAGGTGATGGAAAAGAGACGG - Intronic
1088982394 11:114875492-114875514 ATGGGCTGGTGGGAGAGTGTTGG + Intergenic
1089298777 11:117485353-117485375 CTAAGCTGGTGGAAGGGTGAAGG - Intronic
1089448583 11:118573320-118573342 AGGAGGTGGAGTAAGAGGGATGG + Intronic
1089875928 11:121722443-121722465 AGGGGGTGGTGGGAGGGTGACGG - Intergenic
1089983340 11:122790346-122790368 CTGAGGTGGGAGCAGAGTGAGGG - Intronic
1090115620 11:123968912-123968934 ATGGGGTGGGGGAAGAGGGGAGG + Intergenic
1090595524 11:128316852-128316874 GTGAGGTGATGGAAGAGATAGGG + Intergenic
1090903159 11:131050299-131050321 ATGAGGTGGAGGTGGGGTGACGG - Intergenic
1091811232 12:3399511-3399533 ATGATGTGGTGGAAGGGAGCCGG + Intronic
1092280161 12:7092276-7092298 ATGAGGTGTGTGAAGAGAGAAGG + Intronic
1092559502 12:9596154-9596176 ATGAGGTGGTGGCAGCATGCTGG + Intronic
1093256285 12:16872215-16872237 AACAGGAGGTGGAAGAGTTAAGG - Intergenic
1093449591 12:19299896-19299918 GCGTGGTGGTGGAAGACTGAAGG - Intronic
1094088136 12:26616814-26616836 AGGAGGAGGAGGAAGAGGGAGGG - Intronic
1095405454 12:41862350-41862372 ATGAGGTGGAAGAAGATTTATGG + Intergenic
1095748097 12:45682162-45682184 ATGAGGAGGTGGAAGGGGGATGG - Intergenic
1096599806 12:52721452-52721474 TGGAGGTGGTGGAAGAGGGATGG - Intergenic
1096682165 12:53263189-53263211 ATGAGGAGGAGGAAGAGGAAGGG + Intergenic
1096758961 12:53824105-53824127 ATGAGGTGGTGGCAGATCCAGGG + Intergenic
1097034837 12:56116909-56116931 AAGAGCTGGTGGGAGAGAGAAGG + Intronic
1097152373 12:56988395-56988417 ATCAGGAGATGGGAGAGTGAGGG + Intergenic
1097721861 12:63030461-63030483 ATGAGGTGGGGGATGGGGGAGGG - Intergenic
1099745354 12:86695782-86695804 GTTAGGGGGTGGGAGAGTGAAGG + Intronic
1100043208 12:90345516-90345538 ATGAGCAGGTAGAAGAATGAGGG + Intergenic
1100166891 12:91926041-91926063 ATGGGGTGGGGGGAGGGTGAGGG + Intergenic
1100217433 12:92466812-92466834 ATGAAATGGTGAAAGAGTCAGGG - Intergenic
1100317078 12:93454328-93454350 ATGAGGGGGCTGAAAAGTGATGG - Intergenic
1100376244 12:94018540-94018562 ATGAGGGGGAGAAAGAGTGAAGG - Intergenic
1100640012 12:96473503-96473525 ATGAACTGGGGAAAGAGTGAGGG + Intergenic
1100741748 12:97601489-97601511 ATGACATGGTGGAAGATGGAGGG - Intergenic
1100969046 12:100047089-100047111 ATGTAGTAGTGGAAGATTGAGGG - Intronic
1101583547 12:106065429-106065451 ATAAGGTGTTGAAAGAGTGCAGG - Exonic
1101714453 12:107298306-107298328 ATGAGCAGGTGGAAGAGACACGG + Intergenic
1101797830 12:107992212-107992234 GTGAGGAGATGGGAGAGTGAGGG - Intergenic
1102119694 12:110430296-110430318 AGGAGCAGGTGAAAGAGTGATGG + Intergenic
1102230349 12:111257556-111257578 AGGAGGAGGAGGAAGAGTGAAGG - Intronic
1102394210 12:112574079-112574101 ATGGGTTGGTGGAGGAGGGAGGG + Intronic
1102394242 12:112574189-112574211 AAGAGGTGGTGGAGGAGGCAGGG + Intronic
1102394249 12:112574208-112574230 AGGGGGTGGTGGAGGAGTGAGGG + Intronic
1102394397 12:112574675-112574697 AGGGGGTGGTGGAGGAGGGAGGG + Intronic
1102419929 12:112795443-112795465 TTGATGTGCTGAAAGAGTGAAGG + Intronic
1102891504 12:116561968-116561990 ATGAGGGGGTGGAAGAGAGATGG - Intergenic
1103147784 12:118610467-118610489 GTGGGCTGGTGGAAGAGTGCTGG + Intergenic
1103633076 12:122278657-122278679 ATTAAGTGGTGGAAGAGCTAAGG + Intronic
1105722817 13:23134242-23134264 AGGAGCAGGTGGAAGAGTGATGG - Intergenic
1106333544 13:28762680-28762702 ATGAGGTGGTGTTGGAGGGATGG + Intergenic
1106506086 13:30371588-30371610 ATGATATGGTGGCAGACTGAGGG + Intergenic
1106660935 13:31799142-31799164 GTGAGCTGGTCCAAGAGTGATGG + Intronic
1106676388 13:31963254-31963276 ATGTGGGGGTGGGAGTGTGAGGG - Intergenic
1107228349 13:38077785-38077807 AGGAGGTGGAGAAAGAGAGATGG + Intergenic
1107625687 13:42280804-42280826 TTCAGCTGGTGGAAGAGAGAGGG + Intronic
1107824219 13:44312787-44312809 ATGAGGTGGGGAAAGAGTGAGGG - Intergenic
1107855907 13:44615271-44615293 ATCAGATGGTGGAAGTGTGAGGG + Intergenic
1107924463 13:45245453-45245475 ATGTGGTGGTGGGAGAGGTAAGG - Intronic
1109051218 13:57483449-57483471 GTGAGGTGGGGGGAGAGGGAGGG + Intergenic
1109083972 13:57946370-57946392 AGGTGGTGGTAGAAGAGGGAAGG + Intergenic
1110137958 13:72091467-72091489 ATGAAGTAGTGGAAATGTGAAGG - Intergenic
1111581142 13:90225321-90225343 ACAAGGAGGTTGAAGAGTGAGGG + Intergenic
1112300657 13:98226837-98226859 AAATGGTGGTGGGAGAGTGATGG - Intronic
1113595402 13:111528278-111528300 ATGATGTGGGGGCAGAGTGGTGG + Intergenic
1114148744 14:20009721-20009743 ATGAAGGGTAGGAAGAGTGAGGG + Intergenic
1114811516 14:25905835-25905857 ATGAGCTAGTGGAAAAGTGCTGG - Intergenic
1115094540 14:29618971-29618993 ATGAGGAGGAGGAAGGGGGAGGG + Intronic
1115307072 14:31944403-31944425 ATGAGGAGGAGGAGGAGAGATGG - Intergenic
1116747704 14:48842893-48842915 ATGAGCTAGGGGAAGAGTGGTGG - Intergenic
1117324029 14:54652419-54652441 ATGAGGTGGAGGAATACTGGTGG + Intronic
1118819310 14:69334728-69334750 ACGGGGTGGGGGTAGAGTGAGGG - Intronic
1118907799 14:70035430-70035452 ATGAGGTAGAGATAGAGTGATGG + Intergenic
1119032506 14:71203573-71203595 AACGGGTGGAGGAAGAGTGAGGG + Intergenic
1120112621 14:80575536-80575558 AGAAGGTGGCGGAAGAGGGAAGG + Intronic
1120576700 14:86189912-86189934 ATGATGAGGTGGAGGAGGGATGG + Intergenic
1120646343 14:87079105-87079127 AGGAGGTGATGGAAGTGAGAAGG + Intergenic
1121695212 14:95906895-95906917 TAGAGGTGGTGGAAGAGAAAGGG - Intergenic
1122294204 14:100695918-100695940 ATCAGGGGGTGGAAGAGGGGAGG - Intergenic
1122626875 14:103089466-103089488 ATGATGGGGTGGCAGAGGGAAGG - Intergenic
1123472408 15:20565125-20565147 AGGAGGTGGAGGAGGAGTGGGGG - Intergenic
1123645595 15:22435228-22435250 AGGAGGTGGAGGAGGAGTGGGGG + Intergenic
1123732713 15:23160116-23160138 AGGAGGTGGAGGAGGAGTGGGGG - Intergenic
1123750846 15:23357496-23357518 AGGAGGTGGAGGAGGAGTGGGGG - Intronic
1124039556 15:26088078-26088100 ATGGGGTGGAAGAAGACTGATGG + Intergenic
1124112808 15:26807857-26807879 ATGAGGTGGGGGTAGGGTGGGGG + Intronic
1124283217 15:28381412-28381434 AGGAGGTGGAGGAGGAGTGGGGG - Intronic
1124299482 15:28530201-28530223 AGGAGGTGGAGGAGGAGTGGGGG + Intronic
1124581867 15:30963013-30963035 AACAGGTGGTGGAAGAGAGGCGG + Intronic
1124663801 15:31574021-31574043 ATTAGATGGTAGAAGAGAGAGGG + Intronic
1124786983 15:32690576-32690598 AGGAGGCGGTGCCAGAGTGAAGG - Intronic
1124951829 15:34330214-34330236 ATGGGGTGGAGGAGGAGTGATGG - Intronic
1125693128 15:41612802-41612824 ATGATGTGGTGGAATAAAGATGG - Intergenic
1126502573 15:49362306-49362328 ACGTGGTGGTAGGAGAGTGAAGG - Intronic
1127893553 15:63275918-63275940 GTGAGATGGGGGAAGAGTCAAGG - Intergenic
1128225635 15:65999451-65999473 ATGAGGTGGAGGAAGCAGGAAGG - Intronic
1128565448 15:68697955-68697977 CTGAGGTGCTGGGAGAGTGGCGG + Intronic
1128654159 15:69447162-69447184 AGGCGGTGGTGGAAGATTGGTGG + Intronic
1129118371 15:73379358-73379380 ATGGGAAGGTAGAAGAGTGATGG - Intergenic
1129144063 15:73632436-73632458 ATGAGCTGGGGGAAGAGGGCTGG - Intronic
1129484795 15:75860197-75860219 AAAAGGTGGTGGTAGAGAGAAGG - Intronic
1129510077 15:76115305-76115327 ATCAGGTGATGGGAAAGTGAAGG - Intronic
1129956412 15:79640662-79640684 CTGGGGTGATGGAAGATTGAGGG - Intergenic
1132149238 15:99447758-99447780 TTAACGTGGGGGAAGAGTGATGG - Intergenic
1133431957 16:5745084-5745106 ATGAGGTGGGGGAAGGGGGAGGG - Intergenic
1134036636 16:11036266-11036288 ATGAGGTGGAGGATGGGGGAAGG - Intronic
1134316940 16:13127325-13127347 ATGAAGGGGTGAGAGAGTGAGGG + Intronic
1134422779 16:14110367-14110389 AAGAGGCGGTGGAGTAGTGAAGG + Intronic
1134558674 16:15188392-15188414 ATGTGGAGGTGGGAGAGTGCAGG - Intergenic
1134919205 16:18099994-18100016 ATGTGGAGGTGGGAGAGTGCAGG - Intergenic
1135276917 16:21121110-21121132 GTGAGAAGGTGGAAGGGTGAGGG + Intronic
1135433613 16:22408896-22408918 AGGAGATGGTGAAATAGTGAAGG + Intronic
1136173487 16:28502423-28502445 ATGGGATGGTGGAGGAGGGAAGG - Intronic
1138140555 16:54564799-54564821 ATGAGCTGGTGGAAATGTGAAGG - Intergenic
1138394429 16:56693008-56693030 ATCGGGTGGTGGGAAAGTGACGG - Intronic
1140004944 16:71065395-71065417 GTGAGGTGGGGGGAGAGGGAGGG + Intronic
1141009807 16:80386995-80387017 ATGACGTGGAGGAGGAGGGAAGG - Intergenic
1142483169 17:230798-230820 ATGAGGTGGAAGAACAGTGAAGG - Intronic
1142945153 17:3420455-3420477 TTGAGGTGTTGGAGGAGTGAGGG + Intergenic
1143017569 17:3899037-3899059 ATGAGGTGGCAGGAGGGTGATGG + Intronic
1143402974 17:6657750-6657772 AAGAGGAGCTGGAAGAGAGAAGG + Intergenic
1143917640 17:10305568-10305590 ATGAGGAGGAGGAAAAGAGAAGG - Intronic
1144038934 17:11391297-11391319 GGGAGGTAGTGGAAAAGTGAAGG + Intronic
1145415329 17:22709930-22709952 ATGAGGGGATGGAAGATGGAGGG + Intergenic
1145905153 17:28512204-28512226 ATGAGGTGGGGCATGAGTGAAGG - Intronic
1146297955 17:31665054-31665076 ATGAGGTGGGAGAAGGGGGAAGG - Intergenic
1146649558 17:34598310-34598332 ATCAGGTGATGGGACAGTGAGGG + Intronic
1147647902 17:42044822-42044844 CTGGGGAGGTGGCAGAGTGAGGG - Intronic
1147808683 17:43150947-43150969 ATGAGGTATGGCAAGAGTGAAGG + Intergenic
1148083459 17:44980111-44980133 GTGAAGTGTTGAAAGAGTGAGGG - Intergenic
1148087534 17:45003405-45003427 AAGAGGTGGAGGCAGAGTGATGG - Intergenic
1148547988 17:48531367-48531389 CTGAGGGGTGGGAAGAGTGAGGG - Intergenic
1148555596 17:48577110-48577132 AAGAGGTGGCGGGAGAGGGAGGG - Intronic
1148555659 17:48577332-48577354 ATGAGGGGGTGGAAGAGGGAGGG + Intronic
1148561240 17:48607839-48607861 AGGAGGAAGAGGAAGAGTGAGGG - Exonic
1149682060 17:58513916-58513938 ATGGAATGGTGGAAGAGGGAAGG + Intronic
1150322211 17:64224695-64224717 ATGCGGTGGTGGAAGGGAGTGGG - Intronic
1151004221 17:70415079-70415101 ATGAGGTGGTAGAATAAAGAAGG + Intergenic
1151449655 17:74190603-74190625 ATGAGTAGGTAGAGGAGTGAAGG - Intergenic
1151766699 17:76136767-76136789 ATGAGGTGGTGGCACAGGGTGGG - Exonic
1153355998 18:4136009-4136031 ATGAGGTGGGGGGAGGGGGAGGG - Intronic
1153391797 18:4570126-4570148 ATGTGGTGGGAGGAGAGTGAGGG - Intergenic
1153841028 18:9008008-9008030 ATGGGGTGGGGGAAGGGGGAAGG + Intergenic
1156332895 18:36141426-36141448 ATTAGGTGGGGGAGGAGAGATGG + Intronic
1156997704 18:43487089-43487111 AGGAGTTGGTGGATGAATGATGG - Intergenic
1157006987 18:43595028-43595050 ATAAGGTGGTGGAAAAATGTAGG - Intergenic
1157420287 18:47541910-47541932 ATTAGGTGGAGGAAGGATGAGGG + Intergenic
1159341759 18:67143029-67143051 ATGAAGTGATGGAAGCCTGATGG + Intergenic
1160032463 18:75274333-75274355 ATGAGGTGGAGGTGGGGTGATGG + Intronic
1160315124 18:77836522-77836544 AAGAAGTGGTGGAAAAGGGAAGG + Intergenic
1161489089 19:4552121-4552143 GTGAGATGGAGGAAGAGGGAAGG - Intronic
1163496142 19:17647648-17647670 GAGAGGAGGTGGAAGGGTGAAGG - Intronic
1163674268 19:18647540-18647562 AGGAGGAGGAGGAAGAGTGGAGG + Intronic
1165346155 19:35249788-35249810 GTGAGGTGGTGGGAGGCTGATGG + Intronic
1165906579 19:39197995-39198017 GTGAGGCGGTGGAAGATGGAGGG + Intronic
1166220276 19:41359898-41359920 ATGAGGGAGGGGGAGAGTGATGG - Intronic
1166335316 19:42102662-42102684 ATGAGGTAGGGAAAGAGGGAGGG + Intronic
1166356214 19:42229089-42229111 ATGGGGTGGTAGAAGGGTGAGGG + Intergenic
1167286579 19:48601808-48601830 AGGAGATGGTGGAGGAGGGAAGG + Intronic
1167623008 19:50569088-50569110 ATGAGAGGATGGAAGAGGGAGGG + Intergenic
1168162982 19:54524664-54524686 ATGAGGTGTGGGGAGAGGGATGG + Intergenic
1168246434 19:55114978-55115000 ATGAGATGGTGGACGAGGAAGGG + Intronic
1168594109 19:57661237-57661259 TTGAGGTTGTGGAAGAAGGAGGG - Intergenic
925455282 2:4011015-4011037 ATGAGGTGGTTGAGGAGAGGAGG - Intergenic
927232682 2:20840291-20840313 AGTAGGTGGTGGATGAGGGAGGG + Intergenic
927239170 2:20905018-20905040 ATGAGGTGGTGTATTAGTCAGGG - Intergenic
927559750 2:24061504-24061526 CTGAGGTAGTGGAAGAGTTGGGG + Intronic
928137405 2:28698237-28698259 AAGAGGAGGAGGAAGAGAGAAGG - Intergenic
928471408 2:31580384-31580406 ATGAGGTCCTGGGGGAGTGAAGG + Intronic
929043372 2:37768317-37768339 AACAGGAGGTGGAAGATTGATGG - Intergenic
929061667 2:37930813-37930835 AGGAGGTGCTAGCAGAGTGAGGG + Intronic
931148105 2:59542133-59542155 AGGAGGAGGAGGAAGAGAGAAGG + Intergenic
931565736 2:63614065-63614087 GGGAGGTGGTGGGATAGTGACGG - Intronic
931850140 2:66244519-66244541 AAGAGGTTGTGGGATAGTGAGGG - Intergenic
932131295 2:69189718-69189740 ATGAGCAGGTGGCAGAGAGAAGG + Intronic
932292746 2:70596337-70596359 AAGAGGTGGTGGAAGAGGGTAGG - Intergenic
933078996 2:77965749-77965771 AAGAGGTGGAGGGATAGTGAGGG - Intergenic
933658720 2:84909326-84909348 GTGTGGTGGTGGAGGTGTGATGG - Intergenic
934653261 2:96104220-96104242 AGGAGGAGGGGGAAGAGGGAGGG - Intergenic
935844836 2:107154393-107154415 ATGAGGAGGTGGCAGAGAGAGGG + Intergenic
935935749 2:108181408-108181430 ATGAGATGGGAGAAGTGTGAGGG + Intergenic
936270068 2:111042532-111042554 AAGTGGAGGTGGCAGAGTGAAGG + Intronic
936471881 2:112805964-112805986 AAGAGGTGAAGAAAGAGTGAAGG + Intergenic
936594324 2:113833353-113833375 CTGAGTTGCTGGAAGAGAGAGGG - Intergenic
936618649 2:114073192-114073214 TGGAGGTGGAGGAAGAGTGAAGG + Intergenic
937509998 2:122584425-122584447 ATGGGGTGGGGGAAGGGGGAGGG + Intergenic
938000826 2:127735252-127735274 ATCAGGTGGAGGAGGGGTGAGGG - Intronic
938549962 2:132370814-132370836 ATGGGGTGCTGGAAGGGAGATGG + Intergenic
938762944 2:134441872-134441894 TTGAGGTGCTGGAAGAAAGAAGG - Exonic
938792974 2:134692951-134692973 CTGAGGTGCTGGAAGAAAGATGG - Intronic
939064848 2:137470865-137470887 AAGGGCTGGTGGAAGAGGGAGGG - Intronic
939284556 2:140112037-140112059 AAGAGGTAGAGAAAGAGTGAGGG + Intergenic
939449125 2:142349602-142349624 ATGAACTGGTGGAAGACTGCAGG - Intergenic
939894753 2:147777621-147777643 AGGAGGTGGTGGTGGAGGGAAGG - Intergenic
940674012 2:156706563-156706585 ATGTGGTGGAGGAAGATTTATGG - Intergenic
942187272 2:173436286-173436308 AGGAGGTGGTGGAAGATTAGAGG + Intergenic
942309405 2:174641259-174641281 ATGAGGTCTTGGAAAAGTAATGG - Intronic
942431837 2:175920295-175920317 ATGGGGTGGGGGAAGGGGGAGGG + Intergenic
942646232 2:178113142-178113164 AAGAGCTGGTGGATTAGTGAGGG - Intronic
943521016 2:188949399-188949421 ATGAGGAGCTGGAAGTGGGAAGG - Intergenic
943540819 2:189212052-189212074 AGGAGGAGGTGGCACAGTGAGGG + Intergenic
943862648 2:192888624-192888646 GGGAGGTGGTGGGAAAGTGAGGG + Intergenic
944290281 2:197996980-197997002 GTGAGGTGGCGGGAGAGGGAAGG + Intronic
945045457 2:205777531-205777553 AGGAGGAGGTGGACGAGAGAAGG + Intronic
945517370 2:210779076-210779098 AGGAGGAGGTGGGAAAGTGAAGG + Intergenic
946685842 2:222268902-222268924 AGGAGGGGGTGGAAGAGGGCTGG - Intronic
946716132 2:222556671-222556693 AGGAGTGGGGGGAAGAGTGAAGG - Intronic
946719617 2:222590364-222590386 ATGGGGTGGGGGAAGGGGGAGGG + Intronic
947129167 2:226903988-226904010 ATGGGGAGGTGGAAGAAGGATGG - Intronic
947363431 2:229369564-229369586 CTGTGGTGGTGGAGGAGGGAAGG + Intronic
947432757 2:230045151-230045173 ATGGGGTGATGGAATACTGACGG - Intronic
948711459 2:239828075-239828097 ATGAGGTGAAGGGAGAGGGACGG + Intergenic
948856376 2:240732325-240732347 ATGAGGGGGTGAAGGAGTGAGGG + Intronic
948915793 2:241034539-241034561 GTGGGGTGGGGGCAGAGTGAGGG - Intronic
949081139 2:242100597-242100619 AGGAGGTGGTGGATGAGGAAGGG + Intergenic
1169292976 20:4368528-4368550 AAGAGGTAGTGCAAAAGTGAAGG + Intergenic
1169685644 20:8268108-8268130 ATGAGGTGGGGGGAGAGGGGAGG - Intronic
1169790422 20:9404189-9404211 TTGAGGAGGTGGAAGAGGGTGGG + Intronic
1169854669 20:10089895-10089917 ATGTGGTGGTGTGGGAGTGAGGG + Intergenic
1171504503 20:25622999-25623021 ATGAGGTAGTGGAAGATCCAGGG + Intronic
1172315953 20:33954620-33954642 GTGAGGTGCTGGAAGAGACAGGG - Intergenic
1172993546 20:39053254-39053276 AAGAGGGGGAGGAAAAGTGAAGG + Intergenic
1173543036 20:43868981-43869003 ATAAGGGGGTGGCAGGGTGAGGG + Intergenic
1174604386 20:51750367-51750389 ATGAGGTGAGGGAGGAGTGCTGG - Intronic
1174905869 20:54550532-54550554 ATGTGGTGGTGGAGGAGAGAGGG - Intronic
1175497977 20:59428215-59428237 ATGAGTGGGTGAATGAGTGAAGG - Intergenic
1175843703 20:62048003-62048025 ATGAGGGGGTGGTCCAGTGAGGG - Intronic
1177835217 21:26180045-26180067 ATGAAGAGGTGAAAGAGTAAGGG + Intergenic
1178226469 21:30725172-30725194 AGGAAGAGGTGGAAGAGTGAGGG + Intergenic
1178263641 21:31122493-31122515 ATGAGGTGATGGATGACAGATGG + Intronic
1179714568 21:43280502-43280524 GGGAGGTGGAGGAAGAGGGAAGG + Intergenic
1180207726 21:46272373-46272395 CTGAGCTGGGGGAAGAGCGATGG - Intronic
1180669129 22:17539511-17539533 GTGAGGTGGGGGAAGAGGGGAGG + Intronic
1180673270 22:17569836-17569858 ATGAGGGGGAGGCAGAGGGAGGG + Intronic
1181682094 22:24502444-24502466 ACCAGGTGGTGGTAGAGAGATGG - Intronic
1182077474 22:27504782-27504804 ATGGGGTGGTGGAGGGGTGGGGG + Intergenic
1183040332 22:35173010-35173032 GTGAGGTAGTGGGAGAGGGATGG + Intergenic
1183244803 22:36685498-36685520 GTGAGGTGGGGGCAGAGCGATGG - Intronic
1183830491 22:40416207-40416229 ATGAAGTGGGGGGAGAGGGAAGG - Intronic
1184306463 22:43606161-43606183 ATGAGGAAGTGGAAGAGTGATGG - Intronic
1184502741 22:44883585-44883607 AGGAGGAGGAGGAAGAGTGTGGG - Intronic
1184526675 22:45027997-45028019 AGGAGGAGGTGGAAGGGAGAGGG + Intergenic
949482809 3:4510139-4510161 AAGTGGTGGTGGGAGAGGGAGGG + Intronic
949569052 3:5274096-5274118 AAGATGTGGTGGAAGAGGAAGGG + Intergenic
950133037 3:10560637-10560659 AGGAGGTGGTAGCAGAGGGAAGG - Intronic
950139849 3:10607939-10607961 AGGAGCAGGTGGAAGAGAGAGGG - Intronic
950259296 3:11532383-11532405 AGGAGGTGGAGGCAGAGAGAGGG + Intronic
950625801 3:14245980-14246002 GTGAGCTGGGGGAAGACTGAGGG + Intergenic
951162813 3:19446593-19446615 ATGAGGAGGTGGGAAAGAGAAGG + Intronic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951210638 3:19970640-19970662 ATGAAGCGGTCTAAGAGTGATGG + Intronic
952114689 3:30164359-30164381 ATGAGGTATGGGAAGGGTGAAGG + Intergenic
952520626 3:34153117-34153139 AGCAGGTGGGGGAAGAATGAGGG + Intergenic
952883680 3:38000395-38000417 ATGAGGAGGAGGCAGAGGGAAGG + Intronic
952975094 3:38687086-38687108 ATGAGGTCAGGGAGGAGTGAGGG + Intergenic
954596094 3:51826277-51826299 ATGAGCAGGAGGAAGAGAGAGGG + Intronic
955148543 3:56344313-56344335 ATGAGGAGGAGGAGGAGGGAAGG - Intronic
955780832 3:62482907-62482929 CTGACGTGATGGAAGAGAGATGG + Intronic
955964823 3:64378460-64378482 ATGAGTTGGAGAAAGAGTGGTGG - Intronic
956158454 3:66323193-66323215 AAGGGGTGATGGAAGAGAGAGGG + Intronic
956190397 3:66602291-66602313 AGGAGGAGGAGGAAGAGAGAAGG - Intergenic
956951683 3:74291041-74291063 ATGAGGTGGGGGAAGGGGGGAGG - Intronic
957511092 3:81188301-81188323 ATGAGGAGAGGGAAGAGTTAAGG - Intergenic
958107873 3:89101377-89101399 TTGAGATGGTGGAGGAGTGAAGG - Intergenic
958884742 3:99713293-99713315 ACTAAGTGGTGGAAGATTGAAGG - Intronic
959123568 3:102262990-102263012 TTGGGGAGGTGGATGAGTGATGG + Intronic
960405366 3:117253059-117253081 TTGAGGTTGGTGAAGAGTGAAGG + Intergenic
960812057 3:121635022-121635044 ATGAGGTTGAGGATGAGTGGTGG - Intronic
961185582 3:124912321-124912343 ATGGGGTTCTGGAAGGGTGAGGG + Intronic
961337977 3:126195961-126195983 ATGGGGTGGGGGAAGAGGGGAGG + Intronic
961419108 3:126785969-126785991 GTGGGGTGGGGGAAGAGGGAAGG - Intronic
961720923 3:128895546-128895568 ATGAGGTGTGGCCAGAGTGAGGG - Intronic
963017155 3:140835592-140835614 ATTGGGTGGTGGAAGAGAGAGGG + Intergenic
963234713 3:142945532-142945554 ATGGGGAGGTGGAAGGGGGATGG + Intergenic
963754538 3:149220161-149220183 ATCAGGGAGTAGAAGAGTGAAGG - Intronic
963950209 3:151191003-151191025 ATGTAGTGGTAGAAGAGTGATGG + Intronic
964254746 3:154763526-154763548 TAGAGGTGGTAGAAGAGGGAAGG - Intergenic
965157354 3:165080751-165080773 ATGAGGTGGAGGAAGGGGGGAGG + Intergenic
965986253 3:174757348-174757370 ATGAGGAGGTGTTAAAGTGAAGG + Intronic
966569421 3:181424372-181424394 AGGAGGTGGTGGAAGTATTATGG + Intergenic
967230913 3:187336671-187336693 AAGATGTGGAGGAAGAGTGTGGG - Intergenic
967787352 3:193512029-193512051 CTGAGGTGCTGGCAGAGTTATGG - Intronic
968945392 4:3660975-3660997 AGGAAGGGGTGGTAGAGTGAGGG + Intergenic
968952023 4:3700262-3700284 AGGAGGAGGGGGAAGAGTGGAGG + Intergenic
968952787 4:3703285-3703307 AAGAGGGGGGGGAAGGGTGAGGG + Intergenic
969907855 4:10414116-10414138 AGGAGGAGGAGGAAGAGTTAAGG - Intergenic
971266582 4:25101222-25101244 GTGAGGAGGTGGAAGAGGGGAGG - Intergenic
972423942 4:38915306-38915328 ATGAGGTGGGGGGATAGTGGTGG - Intronic
972658330 4:41088585-41088607 ATGAGGCCCTGGAAGAGGGAGGG - Intronic
973542423 4:51947644-51947666 ATGGGGTGGTGGATGGGGGAGGG - Intergenic
973700852 4:53535755-53535777 ATGAGGAAGTGAAAGAGAGATGG - Intronic
974242451 4:59267608-59267630 AAGAGGTGGAGGAAGTGTAAAGG + Intergenic
974635844 4:64563410-64563432 ATGAGGGGGTGCAAAAGTGTAGG - Intergenic
974750481 4:66134013-66134035 GTGAGGTGGGGGAAGAGGGGAGG + Intergenic
975329502 4:73098786-73098808 AGGAGCAGGTGGAAGATTGATGG - Intronic
975413205 4:74079225-74079247 AGGAGGAAGTGGGAGAGTGAAGG + Intergenic
976589663 4:86836509-86836531 CTCACGTGGTGGAAGAGAGAAGG - Intronic
976634547 4:87274851-87274873 AGGAGGAGGAGGAAGAGTAAGGG + Intergenic
976806653 4:89054831-89054853 GTGAGGTGGTGGAAAGGTGAGGG - Intronic
977213437 4:94247978-94248000 AGGATGTGGGGGAAGAGTTAAGG - Intronic
978594116 4:110358135-110358157 TTGAGATGGGGGAAGACTGAGGG + Intergenic
979285541 4:118920122-118920144 ATAAGGTGGTTGAAGAGTTGTGG + Intronic
980034304 4:127865894-127865916 GTGGGGTGGGGGAAGAGGGAGGG + Intergenic
980284692 4:130767993-130768015 AAGAGGTTGTGGGATAGTGAGGG - Intergenic
980653965 4:135758684-135758706 ATGAGATGTGGGAAGAGTCAGGG - Intergenic
980849851 4:138367695-138367717 ATGAGGTGGAGGAAAAGGGAGGG - Intergenic
981028194 4:140097328-140097350 ATGAGGTGGTGAAAGGTGGAGGG - Intronic
981309746 4:143285638-143285660 ATGGGGTGGGGGAAGAGGGGAGG - Intergenic
981509479 4:145540012-145540034 CTGAGCTGGTGGGAGAGTGAGGG - Exonic
982452185 4:155566282-155566304 ATTAGGTGGTGCAAGTATGAAGG + Intergenic
982561755 4:156936550-156936572 ATGAGGTAGATGAAGAGTGTAGG + Intronic
982821398 4:159944454-159944476 AGGAGGAGATGGAAGAGAGAAGG - Intergenic
984824478 4:183912361-183912383 AAGAAGAGGTGGAAAAGTGAGGG - Intronic
985302246 4:188503259-188503281 ATAAGGTCATGGAAGAGAGAGGG + Intergenic
985302264 4:188503380-188503402 ATAAGGTGCTGGAAGAGAGAGGG + Intergenic
985302273 4:188503440-188503462 ATAAGGTCCTGGAAGAGAGAGGG + Intergenic
985302371 4:188504229-188504251 ATAAGGTGCTGGAAGAGAGAGGG + Intergenic
985302379 4:188504289-188504311 ATAAGGTCCTGGAAGAGAGAGGG + Intergenic
985302454 4:188504955-188504977 ATAAGGTGCTGGAAGAGAGAGGG + Intergenic
985302462 4:188505015-188505037 ATAAGGTCCTGGAAGAGAGAGGG + Intergenic
985302656 4:188506526-188506548 ATAAGGTGCTGGAAGAGAGAGGG + Intergenic
985302723 4:188507073-188507095 ATAAGGTGCTGGAAGCGAGAGGG + Intergenic
985302755 4:188507313-188507335 ATAAGGTGCTGGAAGAGAGAGGG + Intergenic
985302771 4:188507434-188507456 ATAAGGTGCTGGAAGAGAGAGGG + Intergenic
985302787 4:188507552-188507574 ATAAGGTCCTGGAAGAGAGAGGG + Intergenic
985302835 4:188507910-188507932 ATAAGGTCCTGGAAGAGAGAGGG + Intergenic
985302853 4:188508030-188508052 ATAAGGTCCTGGAAGAGAGAGGG + Intergenic
985303023 4:188509362-188509384 ATAAGGTGCTGGAAAAGAGAGGG + Intergenic
986566777 5:9123505-9123527 GAGAGGAGGAGGAAGAGTGAAGG + Intronic
987261181 5:16205172-16205194 ATGAGGTGCAGGGGGAGTGAGGG + Intergenic
987910163 5:24132480-24132502 AGGAGGAGGTGGGAGAGGGATGG + Intronic
987960471 5:24802148-24802170 ATGAAGACGAGGAAGAGTGAAGG - Intergenic
988029068 5:25739206-25739228 CTGAGCTGGTGGAACAGTGCAGG - Intergenic
988744044 5:34114791-34114813 ATGATGTGTTAGAAGAGAGATGG - Intronic
988768979 5:34411888-34411910 ATGAGAAGGTGGGAGAGAGATGG + Intergenic
989143101 5:38221580-38221602 ATGAGGAGGTAAAAGAGTGGGGG - Intergenic
989291287 5:39769351-39769373 GGGAGGTGGTGGCAGAGGGAGGG + Intergenic
989512115 5:42300234-42300256 ATAAGGAGATGGAAGAGTAAAGG - Intergenic
989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG + Intronic
989848167 5:46172392-46172414 ATGAGGTGGGGGAAGGGGGGAGG + Intergenic
991268478 5:64750471-64750493 GTGAGGTGGTGGGGGAGTGGTGG - Intronic
992756181 5:79908289-79908311 ATGGGGTGGAGGAAGGGGGAAGG + Intergenic
992992494 5:82298432-82298454 ATGGGGAGCTGGAAGGGTGATGG + Intronic
993108852 5:83631009-83631031 ATGAGCTACTGGAGGAGTGAGGG + Intergenic
993399643 5:87432600-87432622 TTCATGTGGTGGAAGAGGGAAGG - Intergenic
993642994 5:90428378-90428400 AAGAGTTGGGGGAAGAATGAAGG + Intergenic
994039222 5:95238800-95238822 GGAAGGTGGTGGAATAGTGAGGG - Intronic
995192983 5:109339272-109339294 ATGAAGATTTGGAAGAGTGAGGG + Intronic
995915962 5:117245192-117245214 AGGAGGTGGAGGAAAAGTGGAGG + Intergenic
996574279 5:124964470-124964492 ATGAAGTGGTGGAAGAATTTTGG + Intergenic
996642442 5:125772574-125772596 AAGAGGTGGTTGATGACTGAAGG + Intergenic
996792229 5:127305358-127305380 TTGAGGGGGTGAAAGTGTGAGGG + Intronic
997481619 5:134189315-134189337 GTGAGTTGGTGGAAGTATGATGG - Intronic
999119588 5:149198805-149198827 ATGAGGTGGTGCCAGGATGATGG - Intronic
999563219 5:152827922-152827944 ATGAGGTGGAGAAAGAGACAAGG + Intergenic
1000110080 5:158099851-158099873 ATGAGGCGGTGGAAGATAAAGGG + Intergenic
1000898832 5:166889169-166889191 ATGAGGTGGAGAAACAGTGAAGG + Intergenic
1001599305 5:172918815-172918837 ATGAGGTGGGGACAGAGGGAGGG - Intronic
1002112739 5:176930177-176930199 ATGGGGTGGAGGCAGAGAGATGG - Intronic
1003021997 6:2517828-2517850 AGGAGGCGGGGGCAGAGTGAGGG - Intergenic
1003396093 6:5753140-5753162 ATGAGGTGGAGAGAGGGTGAGGG + Intronic
1003543841 6:7041749-7041771 ATCAGGAGGTAGAAGAGAGAGGG + Intergenic
1003621634 6:7705910-7705932 ATGAAGTGGGGTCAGAGTGAAGG + Intergenic
1003797503 6:9621353-9621375 GTGAGATGCTGGTAGAGTGATGG - Intronic
1005533203 6:26729301-26729323 ATGTGGTTGGGGAAGAGTGGAGG - Intergenic
1005537591 6:26772363-26772385 ATGTGGTTGGGGAAGAGTGGAGG + Intergenic
1006473430 6:34240745-34240767 AGGAGCAGGTGGAAGAGTGATGG - Exonic
1006981038 6:38148472-38148494 ATGAGGTAGAGGAAGTGTTAAGG + Intronic
1007326087 6:41061043-41061065 ATGTTGTGCTGGAAGAGTGATGG + Intronic
1007951446 6:45876093-45876115 ATGAGGTGGCAGAGGAGTGGGGG + Intergenic
1008307298 6:49918850-49918872 ATGAGCTGGTGGAAGTGTGATGG - Intergenic
1008354587 6:50537141-50537163 GTGAGGTGGGGGAAGAGGGAGGG - Intergenic
1009008466 6:57814773-57814795 ATGTGGTTGGGGAAGAGTGGAGG + Intergenic
1009277827 6:61706298-61706320 TTGAAGTTGTGGAAGAGTCAAGG - Intronic
1009907062 6:69883203-69883225 ATGAGGGGGAGGAGGTGTGAGGG + Intronic
1010319925 6:74495279-74495301 ATGAGGTGGGGGAGGGGGGAGGG - Intergenic
1012271544 6:97218398-97218420 ATGAAATGGTGAAAAAGTGATGG + Intronic
1013761875 6:113528277-113528299 CTGAAGAGGTGGAAGAATGAAGG + Intergenic
1013952601 6:115802699-115802721 ATGAGCTAGTGGAAGAGTAATGG + Intergenic
1014703308 6:124715767-124715789 AGGAGGAAGAGGAAGAGTGAAGG - Intronic
1015208257 6:130666593-130666615 TGGAGGTGGTGGAGGAGGGATGG - Intergenic
1016854702 6:148655577-148655599 ATGATGTCCTAGAAGAGTGAAGG - Intergenic
1017577236 6:155818479-155818501 AGGAGGAGGAGGAAGAGAGAAGG + Intergenic
1017779633 6:157705882-157705904 AAGAGGTGGAGGGATAGTGAGGG + Intronic
1018013003 6:159688934-159688956 ATGAGGTGGCAGTAGAGTTAGGG - Intronic
1018829760 6:167433814-167433836 AGGTGGTGGTGGCAGAGTGTGGG + Intergenic
1018829785 6:167433918-167433940 AGGTGGTGGTGGCAGAGTGTGGG + Intergenic
1018829830 6:167434123-167434145 AGGTGGTGGTGGCAGAGTGTGGG + Intergenic
1018829840 6:167434172-167434194 TGGAGGTGGTGGCAGAGTGTGGG + Intergenic
1018829896 6:167434428-167434450 AGGTGGTGGTGGCAGAGTGTGGG + Intergenic
1018829920 6:167434529-167434551 AGGTGGTGGTGGCAGAGTGTGGG + Intergenic
1018829965 6:167434737-167434759 AGGTGGTGGTGGCAGAGTGTGGG + Intergenic
1019419348 7:943420-943442 ATGAGGAGGAGGAAGAGAGGAGG + Intronic
1019419413 7:943664-943686 ATGAGGAGGAGGAAGAGAGGAGG + Intronic
1019999689 7:4748585-4748607 AGGAGGTGGTGGTGGAGAGAGGG + Intronic
1020080147 7:5282585-5282607 GGGAGGTGGAGGAAGAGGGAGGG + Intronic
1020416721 7:7954652-7954674 ATGAGGAGGTAGAAAAGTCAAGG - Intronic
1020497671 7:8876640-8876662 ATGAGGTGGGGGTAGAGGGGAGG - Intergenic
1020640969 7:10753064-10753086 ATGGGGTGGGGGAAGTGGGAAGG + Intergenic
1020938470 7:14499673-14499695 ATGAGCTGGTGGCAGAGCTATGG + Intronic
1021561950 7:21977221-21977243 ATGAGGTGGGGGTAGGGGGAGGG - Intergenic
1022360217 7:29649978-29650000 AGGAGGTGGTGGAAGAGTTGGGG + Intergenic
1022451843 7:30523245-30523267 AGGAGGTGGAGGAGGAGTGGGGG + Intronic
1022542026 7:31146413-31146435 GAGAGGAGATGGAAGAGTGAAGG - Intergenic
1022791423 7:33693014-33693036 ATGGGGTGGTGTAGGAGTGAAGG + Intergenic
1022830633 7:34062460-34062482 ATGAGGTGGGGGTGGGGTGAGGG - Intronic
1023994901 7:45153378-45153400 ATGATGTGGTGGGAGAGGGGAGG + Intergenic
1024287646 7:47773107-47773129 AAGAGTTGGTGTCAGAGTGATGG + Intronic
1024527199 7:50358763-50358785 GAGAGGTGGAGGAAGAGAGAAGG + Intronic
1024550789 7:50561173-50561195 AGGAGGTGGTGGGAGGGTGGAGG - Intronic
1024714600 7:52061872-52061894 GGGAGGTGGTGGGAAAGTGAGGG - Intergenic
1024822377 7:53347910-53347932 ATGGGGTGGGGGAAGTGGGAGGG + Intergenic
1024982954 7:55172955-55172977 ATGAGGTGGAGGAACAAGGAAGG - Intronic
1025100336 7:56129439-56129461 ACCAGGAGGTGGAGGAGTGAGGG + Intergenic
1026146867 7:67754038-67754060 ATGAGGTGGGGGCAGTGTGCTGG + Intergenic
1026318666 7:69250077-69250099 ACTAGGTGTTGGAGGAGTGAGGG - Intergenic
1026541027 7:71280159-71280181 CTGAGGTTGTGGAAGAGACAGGG + Intronic
1026648627 7:72194921-72194943 ATGGGACCGTGGAAGAGTGAGGG - Intronic
1026828600 7:73598342-73598364 ATGGGTTGGTGGATGAATGATGG - Intronic
1026849709 7:73717204-73717226 AGGAGGAGGAGGAAGAGGGAGGG + Intronic
1027351678 7:77317973-77317995 ATAAGGTGGATGAAGAATGAAGG + Intronic
1027916741 7:84334523-84334545 AACAGGTGGAGGAAGAGTGCAGG - Intronic
1028385013 7:90244958-90244980 ATGAGTGGGTGGAGGGGTGAGGG - Intergenic
1028711706 7:93916942-93916964 ATGACAAGGTGGAAGAGTCAGGG - Intergenic
1029048840 7:97661669-97661691 AAGAGGTGGTAGAAAAATGAAGG + Intergenic
1029506860 7:100968101-100968123 ATGAGGAGGAGGGAGACTGAGGG - Exonic
1030896985 7:115072789-115072811 ATGATGTAGGGGAAGACTGAAGG - Intergenic
1030966479 7:115998004-115998026 AGGAGGTAGAGGAAGAGAGAGGG + Intronic
1031420038 7:121540280-121540302 ATTGGGTGGTGGAGGGGTGAAGG + Intergenic
1031715085 7:125099051-125099073 ATAAGGTGTTGGGAGAGTGGAGG - Intergenic
1031942973 7:127808737-127808759 ATGAGGTGGAGTACGAATGATGG + Intronic
1031978517 7:128108756-128108778 TTGAGGTGGTGGGAGATGGAGGG + Intergenic
1032566182 7:132948376-132948398 AGAAAATGGTGGAAGAGTGAGGG + Intronic
1032710171 7:134454308-134454330 AGGAGGTGGTGGAGGACTCAAGG - Intronic
1033410075 7:141109286-141109308 AAGGGGTGGTGAAAGGGTGATGG + Intronic
1033913642 7:146296273-146296295 ATGAATTGGTTGAAGAGTGCAGG - Intronic
1034527926 7:151677825-151677847 ATGTGGTGGAAGAAGATTGATGG - Intronic
1034680150 7:152922467-152922489 GTGTGGTGGTGGAAGAGAGCAGG + Intergenic
1034823579 7:154239399-154239421 ATGAGGAGGAGGAAGAGGAAGGG - Intronic
1036130647 8:6106476-6106498 ATGAGGGGATGGAAGAAAGAAGG - Intergenic
1036155863 8:6341341-6341363 AAGAGGTGGTAGAAGGGAGAAGG - Intergenic
1036371870 8:8169257-8169279 AAGAGGTGGAGGGATAGTGAGGG - Intergenic
1036879032 8:12496387-12496409 AAGAGGTGGAGGGATAGTGAGGG + Intergenic
1037002640 8:13738949-13738971 CTGAGGTAGAGGTAGAGTGAGGG - Intergenic
1037899266 8:22678040-22678062 ATGAGGTGTTCTAAGAGTAAGGG + Intergenic
1039041650 8:33414295-33414317 GGGAGGTGGTGGAAAGGTGAGGG - Intronic
1039064847 8:33599273-33599295 ATGGGATGGGGGAAGCGTGAAGG + Intronic
1039417591 8:37409057-37409079 ATGAGGTGGTCAAAAACTGAGGG + Intergenic
1039786603 8:40839796-40839818 ATGAAGTCTTGGAAGAGTGAGGG + Intronic
1039984280 8:42435084-42435106 ATGAGGAGGAGGAAGTGGGACGG + Intronic
1040444616 8:47481018-47481040 ATGAGATTGTTGAATAGTGATGG + Intronic
1040657498 8:49528652-49528674 ATGAGGTGGGGAAAGGGGGAGGG - Intergenic
1041347893 8:56920499-56920521 AAGAGGAGGAGGAAGAGGGAGGG + Intergenic
1041451084 8:58007456-58007478 ATGGAGGGGTGGAAAAGTGATGG - Intronic
1041713841 8:60915867-60915889 AGGTGATGGTGGAAGAATGAAGG - Intergenic
1041933399 8:63311164-63311186 GTGAGGTGGTGGCAGCGTGGTGG - Intergenic
1042601441 8:70503192-70503214 ATGGGAAGCTGGAAGAGTGATGG + Intergenic
1043729709 8:83660970-83660992 ATGAGTGTGAGGAAGAGTGATGG + Intergenic
1044062396 8:87654040-87654062 ATGGGGTGGGGGAAGAGGGGAGG + Intergenic
1044076897 8:87832814-87832836 ATGAGCTGGTGGAAAAGTACTGG - Intergenic
1044413469 8:91910192-91910214 AGGTGGTGGTGGAAAGGTGATGG - Intergenic
1044635432 8:94319448-94319470 AAAAGGTGAGGGAAGAGTGAAGG - Intergenic
1046069643 8:109234783-109234805 ATGAAGGGGAGGAAGAGAGAGGG + Intergenic
1046373205 8:113339199-113339221 ATGAGGCGGAGGAAGAGAAAGGG - Intronic
1047707156 8:127511242-127511264 ATGAGGTGGGGGGAGGGGGAGGG - Intergenic
1048848861 8:138625212-138625234 ATGAGATGGGGGAAGATCGAAGG + Intronic
1048883063 8:138886024-138886046 AGGAGGTGGGGGAAAAGAGATGG - Intronic
1048992291 8:139767541-139767563 ATGTGGGGGTGGAAGGGGGAGGG + Intronic
1049641233 8:143716857-143716879 ATGGGGTGGGCGCAGAGTGAAGG + Intronic
1050062765 9:1727645-1727667 ATAAGGTGGGGGCAGAGTGTTGG - Intergenic
1050241437 9:3640041-3640063 ACCAGGTGCTGGAAGTGTGAGGG + Intergenic
1050961211 9:11734303-11734325 CTGAGGTGGTGGATGACAGATGG + Intergenic
1051773445 9:20606317-20606339 AGGAGGTGGGGGAGGGGTGAAGG + Intronic
1051781729 9:20696137-20696159 ATGAAATGTGGGAAGAGTGAAGG - Intronic
1052975086 9:34404231-34404253 TTTAGGTGGTGGAAGAGGGAAGG + Intronic
1053062140 9:35040464-35040486 ATCATGTGGTGGATCAGTGATGG + Intergenic
1054834556 9:69662738-69662760 AAGAGGGGCAGGAAGAGTGAAGG + Intronic
1056100552 9:83296824-83296846 AACAGGTGGTGGAAGGGTGAAGG - Intronic
1056154536 9:83820982-83821004 AAGAGGTGGTTGGAGAGTGGAGG + Intronic
1056306399 9:85294931-85294953 ATGAGGTTCTGGAAGAGCCAAGG - Intergenic
1057164312 9:92914155-92914177 AAGAGGAGCTGGAAGAGAGAAGG + Intergenic
1057944011 9:99308971-99308993 AGGAGGTGGTTAAAGAATGATGG - Intergenic
1058196544 9:101983856-101983878 ATGAGCTGGTGGAAAAGTACTGG + Intergenic
1058631740 9:106995957-106995979 ATGGGGTGGGGGTAGAGGGAAGG - Intronic
1059343611 9:113613449-113613471 ATGAGGAGGAGGAAGGGTGTGGG + Intergenic
1060207032 9:121688165-121688187 ATGAGGAGGTGGGAAAATGAAGG - Intronic
1062217085 9:135395016-135395038 ATGAGGGGGTGGATGGGTGGTGG + Intergenic
1062288098 9:135782376-135782398 ATGAAGTGGTGGAGGAGTCCTGG - Intronic
1186598479 X:11010011-11010033 AAGATGTGGTGGGGGAGTGATGG - Intergenic
1186603465 X:11064162-11064184 AACAGGAGGAGGAAGAGTGAAGG + Intergenic
1187445312 X:19355866-19355888 ATGAGATGGAAGCAGAGTGAAGG + Intronic
1188305573 X:28557249-28557271 ATGTGGTGGCAGAAGAGAGAGGG + Intergenic
1188862655 X:35275388-35275410 ATGAAGTGGTGGAAGAATTGTGG - Intergenic
1189018040 X:37304829-37304851 ATGAGGTGGGGGGAGGGGGAAGG - Intergenic
1189758169 X:44293378-44293400 ATGATGTGGTGAAATTGTGATGG - Intronic
1190442802 X:50492777-50492799 AATAGGTGGTGGATGAGAGAGGG + Intergenic
1190520877 X:51278974-51278996 AGGAGGTGGTTCAGGAGTGATGG - Intergenic
1190804594 X:53823060-53823082 ATCAGGGAGTGGATGAGTGAAGG - Intergenic
1192808328 X:74529092-74529114 ATGGGGTGGTGGGAGGGGGAAGG - Intronic
1193026228 X:76848985-76849007 GTGGGGTGGGGGAAGGGTGAAGG + Intergenic
1193400232 X:81033896-81033918 ATGGGGTGGGGGGAGAGGGAAGG - Intergenic
1193688344 X:84606943-84606965 ATGAGGTAGAGGAAGAGTTGAGG - Intergenic
1194078881 X:89433008-89433030 CTGAGATGGTGGAAGGGGGAGGG - Intergenic
1195082709 X:101386298-101386320 TTGAGGGGGTGGAATAGGGACGG - Intronic
1195492073 X:105482482-105482504 ATGATGTGTTGGAAAAATGAAGG + Intronic
1195570244 X:106392492-106392514 AGGAGGAGGAGGAAGAGGGAGGG - Intergenic
1196016348 X:110944434-110944456 AGGAGGAGGAGGAAGAGAGAAGG - Intronic
1196203648 X:112914524-112914546 ATGGGGTGGAGGAAGGGGGAGGG - Intergenic
1196214648 X:113036123-113036145 GTGAGGTGGTGGATGATTGGTGG + Intergenic
1196230837 X:113219117-113219139 CTGAGGTGGAGGAGGAGAGAAGG - Intergenic
1197718870 X:129731121-129731143 ATCAGGTGCAGTAAGAGTGAAGG + Intergenic
1197837923 X:130714855-130714877 AGAAGGTGGTGGAGGAGGGAGGG + Intronic
1198004182 X:132475205-132475227 GAGAGGTGGATGAAGAGTGAGGG - Intronic
1198677908 X:139150480-139150502 ATGAGGTGGTGTTAAAGAGAAGG + Intronic
1198801009 X:140447758-140447780 GTGAGGTGGGGGATGAGGGAAGG - Intergenic
1199508874 X:148597251-148597273 ATGAGGTGGTGGAGGAGCTGAGG + Intronic
1199602995 X:149554073-149554095 GAGATGTGGTGGAAGAGGGATGG - Intergenic
1199647393 X:149925402-149925424 GAGATGTGGTGGAAGAGGGATGG + Intergenic
1199693367 X:150326148-150326170 ATGTGGTGGTGGAAGGAGGAGGG - Intergenic
1201451068 Y:14115898-14115920 ATGAGGTGATGACAGAGAGAGGG - Intergenic