ID: 1077895862

View in Genome Browser
Species Human (GRCh38)
Location 11:6452775-6452797
Sequence CCTGAGCTGCTCAAACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077895862_1077895868 5 Left 1077895862 11:6452775-6452797 CCCTCCAGTTTGAGCAGCTCAGG 0: 1
1: 0
2: 1
3: 15
4: 256
Right 1077895868 11:6452803-6452825 GCTCAATACTGATGAGGCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 114
1077895862_1077895869 6 Left 1077895862 11:6452775-6452797 CCCTCCAGTTTGAGCAGCTCAGG 0: 1
1: 0
2: 1
3: 15
4: 256
Right 1077895869 11:6452804-6452826 CTCAATACTGATGAGGCTTTGGG 0: 1
1: 0
2: 0
3: 13
4: 144
1077895862_1077895867 -1 Left 1077895862 11:6452775-6452797 CCCTCCAGTTTGAGCAGCTCAGG 0: 1
1: 0
2: 1
3: 15
4: 256
Right 1077895867 11:6452797-6452819 GTTCTGGCTCAATACTGATGAGG 0: 1
1: 0
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077895862 Original CRISPR CCTGAGCTGCTCAAACTGGA GGG (reversed) Intronic
900537489 1:3186061-3186083 CCTGAGCTGTACACACTGGGTGG + Intronic
902604616 1:17561881-17561903 CCACAGCTGCTCAATCGGGAAGG + Intronic
904007237 1:27369763-27369785 GCAGAGTTGCTCAGACTGGATGG - Intronic
905620571 1:39442403-39442425 CCTGAGTAGCACAAACTAGAAGG + Exonic
905704103 1:40041062-40041084 CCTGAGGTGCTCTGACTGGAAGG + Intronic
905969610 1:42131589-42131611 CCTGAGCTGCTCAAGTCTGAGGG - Intergenic
907941242 1:59089813-59089835 CCTCAGCTTCTCAAACTGCTGGG - Intergenic
909332582 1:74431745-74431767 TCTGAGCTGCTGACACTGCAAGG + Intronic
910218184 1:84863535-84863557 CCTGACCTCCTTACACTGGAGGG + Intronic
910281444 1:85505986-85506008 CCTGAGCTGCTCACAGTGTCTGG - Intronic
911530698 1:99039830-99039852 CCTGAGATGATCAAGCTTGATGG + Intergenic
911955259 1:104225580-104225602 CCTGATTTGTTTAAACTGGAAGG - Intergenic
912690501 1:111801254-111801276 CCTGTGCTGCACAGACTGCATGG - Intronic
916671267 1:167023167-167023189 CCTCAGCTTCCCAAACTGGTGGG - Intergenic
917336464 1:173928808-173928830 CCTGAGGTGTGGAAACTGGAAGG - Intergenic
917878634 1:179311113-179311135 CCTCAGCTACTCAAAGTGCATGG - Intronic
918616563 1:186550961-186550983 GCCGAGAAGCTCAAACTGGATGG - Intergenic
919598995 1:199599756-199599778 CCTGAGATGCTCAAGCTTGGTGG + Intergenic
920485417 1:206365402-206365424 TGTGAGCTGCTTAAACTGGCAGG + Intronic
920652909 1:207852000-207852022 CCTCAGCTGCACCAACTGTAAGG + Intergenic
921976333 1:221207189-221207211 CCTGGGATGCTCAAGCTTGATGG + Intergenic
922847094 1:228695218-228695240 CCTCAGCTTCTCAAACTGCTGGG + Intergenic
1062870956 10:903889-903911 CCTGTGCGGCTCAAATGGGAAGG + Intronic
1064171512 10:13037858-13037880 CCTTAGTTGGTGAAACTGGATGG + Intronic
1064296934 10:14087560-14087582 GCTGAGGTGCTCAGACTGGCAGG + Intronic
1064354737 10:14606317-14606339 CCTGACCTGCTCACACTAAATGG + Intronic
1064798527 10:19041413-19041435 CTTGAGCTGCTCAAAATAAATGG + Intergenic
1066155471 10:32672255-32672277 CCAGAGCAGCTCAAACTGTGTGG - Intronic
1068818373 10:61344495-61344517 CCTGACCTGCAGAAACTGCAAGG - Intergenic
1071361013 10:84845985-84846007 CCTGACCTTCTCAAAGCGGAAGG - Intergenic
1071480311 10:86060511-86060533 CCTGAGCTGCTCAGCCTCCAAGG - Intronic
1071604237 10:86973578-86973600 TCTGGGCTGTTCAAACTGGTTGG + Intronic
1074170096 10:110924817-110924839 CCTCAGCTTCTCAAAGTGCAGGG - Intronic
1075017222 10:118918869-118918891 CATGAACTATTCAAACTGGAAGG + Intergenic
1075145460 10:119879260-119879282 CATGAGCATCTCAAACAGGAGGG + Intronic
1075185140 10:120249101-120249123 CCTCAGCTGCCCAAAGTGGTAGG + Intergenic
1076639627 10:131905486-131905508 ACTGAGCTCCTCAAGCTTGAAGG + Intronic
1077895862 11:6452775-6452797 CCTGAGCTGCTCAAACTGGAGGG - Intronic
1078021257 11:7657495-7657517 CCTGAGCTGCTCCAAGGGCAAGG - Intergenic
1078093075 11:8279584-8279606 GCTCAGCTGCTCCAACTGTAGGG + Intergenic
1078804120 11:14679685-14679707 CCTGAGCTGCTCCACATGTAGGG - Intronic
1081624550 11:44642170-44642192 CCTCAGCTTCTCAAAGTGGTGGG + Intergenic
1081864038 11:46349979-46350001 ACTGTGCTTCTCAAACTTGATGG - Intronic
1082814913 11:57501289-57501311 CCTGCGCTGCTCATCCTGGGTGG + Exonic
1083933897 11:65860538-65860560 CCTGCGCTGCTCTAAGTGGTTGG - Exonic
1084626525 11:70312092-70312114 CCTCAGCTTCTCAAAGTGCAGGG + Intronic
1084667366 11:70583647-70583669 CCTGAGCCACTCAAGATGGAGGG - Intronic
1086129202 11:83383259-83383281 CCTGGGATGCTCAAGCTGGGTGG + Intergenic
1089490246 11:118878743-118878765 CCTGAGCTGCCTGACCTGGAAGG + Intergenic
1089643179 11:119860930-119860952 CCAGAGCTGGTGAAACTGGCAGG + Intergenic
1090355071 11:126134959-126134981 TCTCAGCTGCTCAATTTGGATGG - Intergenic
1095587323 12:43863653-43863675 CCTGAACTGTTCACACTTGAGGG + Intronic
1100680501 12:96914767-96914789 CCTGAACTGCTCAAGGTGCAAGG - Intronic
1101222085 12:102652103-102652125 CCTGAGCAGCCAAAACTGGAAGG - Intergenic
1106451817 13:29889013-29889035 CCTGAGCTGCTCCACGGGGATGG - Intergenic
1108164622 13:47679112-47679134 CCTGAGATGCTCCAGTTGGAGGG - Intergenic
1109187899 13:59291988-59292010 CCTGAGATGCTCAAGCTTGGTGG + Intergenic
1111931556 13:94517990-94518012 CCTCAGCTGCTCAAAGTGCTGGG - Intergenic
1113504707 13:110807481-110807503 CCTGAGCTGCTCAGAATGGTAGG - Intergenic
1113836725 13:113332910-113332932 CCTGGGCTGCACACACTGGAGGG - Intronic
1115843680 14:37502087-37502109 GCTGGGCAGCTCAAACTGGGTGG + Intronic
1116209197 14:41911254-41911276 CCTGGGAAGCTCAAACTGGGTGG - Intergenic
1116401748 14:44515811-44515833 CCTGGGAAGCTCAAACTGGGCGG - Intergenic
1117981682 14:61348093-61348115 CCGGTGCTGATAAAACTGGAAGG - Intronic
1118092042 14:62492722-62492744 CCTCAGCTTCTCAAAGTGCAGGG + Intergenic
1118395037 14:65328966-65328988 CATGAGCTGAGCAAACTAGATGG - Intergenic
1119398226 14:74344296-74344318 CCTCAGCTTCTCCAACTGGCTGG - Intronic
1119552010 14:75521840-75521862 CTTGAGCTGCTCAATATGGAAGG + Intergenic
1121558733 14:94858384-94858406 CCTGAGCTCCTCCAAAAGGAGGG - Intergenic
1122086035 14:99305570-99305592 CCTCAGCTGCTCAAAGTGCTGGG + Intergenic
1122596402 14:102895991-102896013 GCAGAGCTGTTCAAACTGCAGGG + Intronic
1123413133 15:20075568-20075590 CCTGGGCTGCTCAAAGTGCTGGG + Intergenic
1123522475 15:21082681-21082703 CCTGGGCTGCTCAAAGTGCTGGG + Intergenic
1125873202 15:43121095-43121117 CCTCAGCTTCTCAAACTGTTGGG - Intronic
1127491702 15:59471063-59471085 CCTCAGCTTCTCAAAGTGGTAGG + Intronic
1127576807 15:60299703-60299725 CCTGAGCTAGGCACACTGGAGGG + Intergenic
1127656446 15:61060565-61060587 CCTGAGCAGCTCACATTGGTTGG - Intronic
1127830935 15:62750638-62750660 CAGGAGCTTCTCAAACTTGACGG + Intronic
1128027510 15:64450831-64450853 CCTGAGCTGGTCTCACTTGAGGG + Intronic
1131166852 15:90148148-90148170 CCTCAGCTTCTCAAACTGTTGGG + Intergenic
1131646445 15:94350104-94350126 CCAGGGCTTCTCAAACTTGAAGG - Intronic
1132158516 15:99514448-99514470 CCTGAGCTTCTCTGACTGGGAGG - Intergenic
1134310411 16:13071006-13071028 TCAGAGCTCCTCAAACTGAAAGG - Intronic
1137070090 16:35897517-35897539 CCTTAGCTGAGAAAACTGGAGGG - Intergenic
1138105954 16:54287187-54287209 CCTAAGCTGCTGAAAGTGGCCGG - Intergenic
1138338055 16:56268356-56268378 CCAGAGCTTCTCAATCTAGATGG - Intronic
1139312674 16:66040497-66040519 CTTGTGCTGCTCATAGTGGAAGG - Intergenic
1140174978 16:72649519-72649541 ACTGAGCTACTTAAACAGGATGG + Intergenic
1140197355 16:72866051-72866073 CGTGAGATGCCCAAATTGGAAGG + Intronic
1140783030 16:78313820-78313842 GCTGAGCTCCTTAAACAGGAAGG - Intronic
1142621202 17:1166661-1166683 CCCGCGCTGCCCACACTGGATGG - Intronic
1142627214 17:1199701-1199723 CCTCAGCTGCCCAAAGTGGTGGG + Intronic
1146550588 17:33777192-33777214 CCTGAGCTTCTCAGAATGAATGG + Intronic
1146727302 17:35166717-35166739 CATGGGATGCTCAAGCTGGAGGG + Intronic
1147414933 17:40281797-40281819 CCAGAGCTTCACAAAATGGAAGG - Exonic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148105853 17:45118462-45118484 CATGAGCTGATGACACTGGATGG - Exonic
1152720234 17:81920008-81920030 GCAGAGGTGCTCAAAATGGATGG + Exonic
1156732451 18:40210890-40210912 CATGAGATGCTCATTCTGGAGGG - Intergenic
1158659348 18:59371968-59371990 CCTGAGATGCTCAAGCTTGGTGG - Intergenic
1160812747 19:1020063-1020085 CCTGAGCTCCTGAAGCAGGAAGG + Intronic
1161667140 19:5584129-5584151 CTTTAGCTGCTTTAACTGGAAGG - Intergenic
1162482700 19:10937853-10937875 CCTCAGCTTCTCAAAGTGGTGGG + Intergenic
1163013690 19:14440954-14440976 CCTGACCTCCCCAAACTGGGAGG - Intronic
1163234089 19:16020989-16021011 CCTGACAGGATCAAACTGGAAGG - Intergenic
1163423284 19:17226925-17226947 CCGGAGTCCCTCAAACTGGAGGG - Intronic
1163924127 19:20322365-20322387 CCTCAGCTGCTCAAAGTGCTGGG + Intergenic
1164867667 19:31618239-31618261 CCTCAGCTTCTCAAACTGCTGGG + Intergenic
1165700538 19:37933761-37933783 CCTGGGCTGCACAGACTGCAGGG - Intronic
1165765914 19:38351119-38351141 CCTGAGCTGTACCAAGTGGAAGG - Intronic
1166500849 19:43340103-43340125 CCTGAGCTGCTCCACAGGGAGGG - Intergenic
1166509250 19:43393314-43393336 CCTGAGCTGCTCCACGGGGAGGG + Intergenic
925380465 2:3421877-3421899 GCAGAGCTGCAGAAACTGGAGGG + Exonic
925600492 2:5604095-5604117 ACTGAGATGCTCAATCTAGAAGG - Intergenic
926096888 2:10087144-10087166 ACTGAGCTGCTCAAACTTCCGGG - Intergenic
927582946 2:24271055-24271077 GCTGAGCTGTACAAAGTGGAAGG + Intronic
927804791 2:26137768-26137790 GCTGGGCTCCTCATACTGGAGGG + Intergenic
928125329 2:28611635-28611657 CTTGAGCTGCTCAACCAGCATGG + Intronic
928965351 2:36969961-36969983 CCTCTGCCGCTCAATCTGGAGGG - Intronic
929257745 2:39830828-39830850 CCTGGGATGCTCAAGCTTGATGG - Intergenic
929858123 2:45652396-45652418 CAGCAGCTCCTCAAACTGGATGG - Exonic
930223335 2:48767590-48767612 CCTGGGATGCTCAAACTTGGTGG - Intronic
931615656 2:64153984-64154006 CCTGAGCTGGTAACACTAGAAGG - Intergenic
931887450 2:66632734-66632756 GCTGGGAAGCTCAAACTGGATGG - Intergenic
932051810 2:68405486-68405508 CCTGGGATGCTCAAGCTGGGTGG + Intergenic
932816076 2:74863239-74863261 ACAGAGCTGCTCCAACTGAAGGG - Intronic
932842905 2:75100238-75100260 CCTCAGCAGCTCAAAGTGGTAGG - Intronic
937372565 2:121310891-121310913 CCTCAGCTTCTCAAACTGCTGGG - Intergenic
941160950 2:162033193-162033215 CCTGAGCAGAGCAAAATGGATGG - Intronic
941885200 2:170520698-170520720 TCTGAGCTGCTCAAGCTGCAGGG + Intronic
1169659054 20:7958179-7958201 GCTGGGAAGCTCAAACTGGATGG - Intergenic
1170552152 20:17487330-17487352 CATGAGCTACTCAAACTAGATGG + Intergenic
1171186401 20:23126975-23126997 CCTGAGATGTTCCAACAGGAGGG + Intergenic
1172448029 20:35003253-35003275 CATCAGCTTCTCATACTGGAAGG - Exonic
1172538347 20:35691798-35691820 CCTGAGCCTCCCAAAGTGGAGGG - Intronic
1172836138 20:37874376-37874398 GCTGAGCTCCTCTACCTGGAAGG + Intergenic
1173233568 20:41222381-41222403 TCTGTGCTGCTAAAACTAGAAGG + Intronic
1173363936 20:42368405-42368427 CCTGGGATGCTAAAGCTGGAGGG - Intronic
1174702837 20:52626330-52626352 CCTGAGATGCTTATTCTGGAGGG - Intergenic
1176053502 20:63133166-63133188 CCTGAGCTGGTGGAACTGGCCGG + Intergenic
1176954443 21:15084929-15084951 TATGTGCTGCTCAAACTGAATGG + Intergenic
1179062734 21:37994796-37994818 CCAGAGCTTGTCAAGCTGGAGGG + Intronic
1179485945 21:41710870-41710892 CCTGCGCTGCTCGGACTCGAAGG - Intergenic
1181871269 22:25901133-25901155 CCTGAGCTGTTCCAACAGGAGGG + Intronic
1181999898 22:26911651-26911673 CCTTAGCTGTTCACACGGGATGG + Intergenic
1182017881 22:27056075-27056097 GCTGAGGTGCTCACACTGAAAGG - Intergenic
1182425247 22:30268137-30268159 CCTGAGCTGCTCCAGCTGGAGGG + Intergenic
1183527408 22:38331702-38331724 CCTCAGCCTCTCAAACTGCAGGG + Intronic
1184224904 22:43124066-43124088 CAGGAGCTGCTCATACAGGAGGG - Exonic
949943942 3:9175537-9175559 CCTGAGCTGCCCCACCTTGAGGG - Intronic
949951221 3:9230360-9230382 CCTGACATTCTCAAACTGGATGG + Intronic
950403276 3:12787657-12787679 ACTGAGCTGCTCTATCTGCAGGG + Intergenic
951356828 3:21677420-21677442 CCTGAGTTGAGCAAAATGGATGG - Intronic
951747828 3:25999075-25999097 CCTGAGATGCTCGAATTGGGTGG - Intergenic
952098595 3:29985141-29985163 GCTGAGATGTTCAAACTGGGTGG - Intronic
953051569 3:39349051-39349073 CCTGAGCTACTCCAAATGAAAGG + Intergenic
953243528 3:41170319-41170341 CCTGAGTAGCTAAAACTAGAGGG + Intergenic
954287830 3:49631303-49631325 CCTCAGCTGCTCAAAGTGTTGGG - Intronic
955840918 3:63111824-63111846 CCTGGGCTTCACAAACTGGAAGG + Intergenic
957169360 3:76718046-76718068 CATAACCTGCCCAAACTGGATGG + Intronic
957210388 3:77251050-77251072 CCTGAGCTCCTGGAACTGCAGGG - Intronic
959360180 3:105379402-105379424 CCTGAGATGATAAAACTGAAAGG - Intronic
962900407 3:139756604-139756626 CCTGATCTCCTCAGAATGGAAGG + Intergenic
962976061 3:140446861-140446883 CCTGTGCTGCTCTAACAGAAAGG - Intronic
964490110 3:157227258-157227280 CCTGAGCAGCTGAATGTGGAGGG + Intergenic
965295666 3:166942847-166942869 CCTCTACTGCTCAAAATGGAGGG + Intergenic
967215371 3:187205067-187205089 CCTCAGCTGCTCAAAGTGCTGGG + Intergenic
967840640 3:194002425-194002447 CATGGGCTGCTCTTACTGGACGG + Intergenic
968587117 4:1424384-1424406 CCTCAGCTGCCCAAATTGCAGGG + Intergenic
969164813 4:5298637-5298659 CCTGTGATGCTCAAACTTGGTGG - Intronic
970060308 4:12026039-12026061 CCTTAGCTGCTTAACCTGGCAGG + Intergenic
971309752 4:25515108-25515130 CCTGAGCAGTTCAAACTTGGTGG + Intergenic
971713459 4:30146697-30146719 CCTCAGCTTCTCAAAGTGCAGGG - Intergenic
972500600 4:39674529-39674551 CCTGAGCTTCTCAAATTGTTGGG + Intergenic
973793107 4:54395989-54396011 CCTGGGCTTCTAAAACTGGGTGG + Intergenic
974827660 4:67151589-67151611 ATTGAGCTGCTAAAACTGTAAGG - Intergenic
976975860 4:91165581-91165603 CCTGGGAAGCTCACACTGGATGG - Intronic
977645363 4:99405741-99405763 CCTGAAAGGCCCAAACTGGATGG + Intergenic
981415021 4:144482928-144482950 GCTGAGAAGCTCAAACTGGGTGG + Intergenic
982579810 4:157162980-157163002 GCTGAGAAGCTCAAACTGGGTGG - Intronic
985286072 4:188337219-188337241 GCTGAGCTGCAGAAACTTGAGGG - Intergenic
988051524 5:26037138-26037160 TCTGATTTGTTCAAACTGGATGG - Intergenic
989519894 5:42389387-42389409 CCTCAGCTGCCCAAAGTGCAGGG - Intergenic
992479449 5:77135865-77135887 CCTCAGCTGCTCAAAGTGCTGGG + Intergenic
993578910 5:89635582-89635604 GCTGGGAAGCTCAAACTGGATGG - Intergenic
994266561 5:97723422-97723444 GCTGGGAAGCTCAAACTGGATGG - Intergenic
995111860 5:108437556-108437578 CCTGAGATGCTCAAGCTTGGTGG + Intergenic
995504394 5:112843875-112843897 CTTGAGCTGCTAGAACTGAATGG - Exonic
996321568 5:122222711-122222733 CCTCAGCAGCTCAAACTGTGAGG - Intergenic
996410357 5:123151969-123151991 CCTGTGCTGGTAAAAATGGAGGG + Intronic
998292533 5:140928427-140928449 CCTGAGCTGCTCAAAGTCAAAGG - Exonic
999727873 5:154451962-154451984 CCTAGGCTTCTCAAACTGGAAGG + Intronic
999814574 5:155163245-155163267 CCTGGGAAGCTCAAACTGGGTGG - Intergenic
999977322 5:156924580-156924602 TCTGACCTGCACAAACTCGATGG - Intronic
1001636048 5:173211193-173211215 CCTGTGCCGCTTAAACTGGTCGG - Intergenic
1002419896 5:179139980-179140002 CCTGACATCCTCAAACGGGACGG - Exonic
1002480371 5:179497029-179497051 CCTGACCAGCTCAGTCTGGAGGG + Intergenic
1002669249 5:180852305-180852327 CCTCAGCTTCTCAAAGTGGTGGG - Intronic
1002803412 6:548892-548914 CCTGAGCTGTTCAAAAGTGAGGG - Intronic
1004990013 6:21126315-21126337 CCAGAGATTCTCAAACTTGATGG + Intronic
1006378350 6:33684101-33684123 CCTGAGCTGCTCTTCCTGGAGGG + Exonic
1006521183 6:34572150-34572172 CCAGAGCTGCTCCACCTGGCTGG + Intergenic
1006741574 6:36312727-36312749 GCTGAGATGCTCACCCTGGAAGG - Intergenic
1008162757 6:48098782-48098804 CCATAGCTACTCAAACAGGATGG - Intergenic
1008291913 6:49725859-49725881 CCTGGGCTTCTCAAAGTGCAGGG + Intergenic
1009484021 6:64197415-64197437 CTTGAGCTTCTCAAACTGTTGGG - Intronic
1011123190 6:83977508-83977530 CCTGAGTTGGTCAAATTCGAAGG - Intergenic
1012013651 6:93826559-93826581 ACTGAGATTGTCAAACTGGAAGG - Intergenic
1014222477 6:118811715-118811737 CCTCAGCTTCCCAAACTGCAGGG + Intergenic
1015862993 6:137699958-137699980 CCTCAGCTTCTCAAAGTGGTGGG - Intergenic
1016737968 6:147500983-147501005 CCCCAGCTTCTCAAAGTGGAGGG - Intergenic
1019182926 6:170203125-170203147 CCTGGTCTGCACAAGCTGGAAGG + Intergenic
1020136681 7:5591910-5591932 TCTGAGCTGGTCACACAGGAGGG - Intergenic
1023395456 7:39747695-39747717 CCTGAGCTTCACTAACTGCATGG - Intergenic
1024700059 7:51897078-51897100 GGTGAGCTGCACAAAATGGAGGG - Intergenic
1025024725 7:55506887-55506909 CCTCAGCTTCTCAAACTGCTGGG + Intronic
1027640624 7:80729333-80729355 CCAGAGCTTCTCAAACTTGCAGG - Intergenic
1028142369 7:87288259-87288281 CCTGGGATGCTCAAGCTTGATGG - Intergenic
1028213268 7:88101282-88101304 CATGAGCTTCCCAAACTGCATGG + Intronic
1028357377 7:89925729-89925751 CCTGAGCAGCTCACAGTGTAGGG - Intergenic
1029027598 7:97433627-97433649 CCTTATCTCCTCAAACAGGAAGG + Intergenic
1029190950 7:98771840-98771862 CCTGCGTTCCTCAAACTGGAAGG - Intergenic
1029452687 7:100650004-100650026 ACTGAGCTGCTCTGACTGGGTGG - Intronic
1029512310 7:101003550-101003572 CCAGAGCTGGCCAAACTCGAAGG + Exonic
1029999008 7:105037611-105037633 CCTCAGCTGCTCAAAGTGCTGGG + Intronic
1030801340 7:113856559-113856581 CCTGGGATGCTCAAACTTGGTGG + Intergenic
1030871761 7:114764656-114764678 CCTCAGCTGCCCAAACTGACTGG - Intergenic
1032925254 7:136597262-136597284 CCTGAGGTGATAAAACAGGAAGG + Intergenic
1035142989 7:156782793-156782815 CCTCAGCTTCCCAAAATGGAGGG + Intronic
1038076853 8:24085487-24085509 CCTCAGCTGCCCAAACTGCTAGG + Intergenic
1038850750 8:31273794-31273816 CCTGAGCAGCTCAAACTACAGGG - Intergenic
1042825111 8:72972155-72972177 CCTCAGCCTCCCAAACTGGAAGG - Intergenic
1043530156 8:81140679-81140701 CCTCAGTTGCCCAGACTGGAGGG - Intergenic
1043713013 8:83446433-83446455 CATGAGCTGTTCATTCTGGAAGG + Intergenic
1044282786 8:90375918-90375940 GCTGAGAAGCTCAAACTGGGTGG + Intergenic
1045071139 8:98506049-98506071 CCTGGGAAGCTCAAACTGGGTGG - Intronic
1045266026 8:100619305-100619327 TCTGAGCTGCACAAACTGTGAGG + Intronic
1045482162 8:102601160-102601182 CCGGAGCTGTTCAGACTGCAGGG + Intergenic
1047466295 8:125118012-125118034 CCAGAGGTTCTCAAACTTGAGGG + Intronic
1047953251 8:129953240-129953262 CCTGACCTTCCCAAGCTGGAAGG - Intronic
1048231056 8:132642497-132642519 TCTGAAATGCTCACACTGGAAGG + Intronic
1048542459 8:135354863-135354885 GCTGAGCAGCTCCAACTGCAGGG + Intergenic
1048812942 8:138304807-138304829 CCTGGCCTGCTCGAAGTGGAAGG + Intronic
1051144851 9:14016099-14016121 CCTTAGCTTCTCAAAGTGCAGGG - Intergenic
1053115898 9:35502059-35502081 CATGTGCTTCTCAAACTTGATGG + Intronic
1055053196 9:72000149-72000171 GCTGGGAAGCTCAAACTGGATGG - Intergenic
1056417354 9:86389903-86389925 GCTGTGCTGCTCTAACTGCATGG + Intergenic
1056494935 9:87147300-87147322 CCACATCTGCTCAATCTGGATGG + Intergenic
1056655587 9:88506063-88506085 CCTGAGTTGGTAAAAATGGAAGG - Intergenic
1057312186 9:93949469-93949491 CCTGAGCTGCCCAAACACAATGG + Intergenic
1057935458 9:99234825-99234847 CCTGAGATGCCCTAGCTGGAAGG + Intergenic
1058045027 9:100349221-100349243 CCTGAGCAACTCAAAGAGGATGG - Exonic
1059088849 9:111334584-111334606 CCTGGGATGCTCAAGCTTGATGG + Intergenic
1060186985 9:121569448-121569470 CCTGAGCTGATCAATATAGAGGG - Intronic
1060961447 9:127683568-127683590 CCTGAGCTGCCCCAGCTGGGAGG + Intronic
1061069129 9:128297968-128297990 CCTCAGCTTCTCAAACTGCTGGG + Intergenic
1062032610 9:134368438-134368460 CCTGAGCCTCTCATCCTGGAGGG - Intronic
1062300219 9:135862466-135862488 CCAGAGCAGATGAAACTGGATGG - Exonic
1062322931 9:135999141-135999163 CCAGAGCTGCCCACAGTGGAGGG - Intergenic
1185985887 X:4833034-4833056 CCTGAGCTGCCTTAACTGTAGGG + Intergenic
1187312765 X:18161576-18161598 CAGGAGCTGCTCAATCTGAATGG + Intergenic
1188123125 X:26334471-26334493 GCTGGGAAGCTCAAACTGGATGG + Intergenic
1191056218 X:56243871-56243893 GCTGAGGTGCTACAACTGGAAGG + Intronic
1191132627 X:57030871-57030893 CCTGGGATGATCAAACTTGATGG - Intergenic
1191643335 X:63452004-63452026 GCTGGGAAGCTCAAACTGGATGG - Intergenic
1194341922 X:92716072-92716094 CTGGAGAAGCTCAAACTGGACGG + Intergenic
1196230177 X:113212185-113212207 CCGGAGAAGCTCAAACTGGGTGG - Intergenic
1198070685 X:133145503-133145525 CCTGAGCTTCTCAAAGTGCTGGG - Intergenic
1199758187 X:150884426-150884448 CCTCAGCTTCCCAAACTGCAGGG - Intronic
1200650268 Y:5832765-5832787 CCGGAGAAGCTCGAACTGGACGG + Intergenic
1202242084 Y:22781297-22781319 GCTGGGAAGCTCAAACTGGATGG - Intergenic
1202395068 Y:24415041-24415063 GCTGGGAAGCTCAAACTGGATGG - Intergenic
1202475716 Y:25255051-25255073 GCTGGGAAGCTCAAACTGGATGG + Intergenic