ID: 1077896399

View in Genome Browser
Species Human (GRCh38)
Location 11:6456723-6456745
Sequence CACGGGAGAGGGCCTGCGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077896399_1077896405 -1 Left 1077896399 11:6456723-6456745 CCTGGCGCAGGCCCTCTCCCGTG 0: 1
1: 0
2: 3
3: 16
4: 215
Right 1077896405 11:6456745-6456767 GGCCACCGTTTCGTGTGCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 34
1077896399_1077896408 8 Left 1077896399 11:6456723-6456745 CCTGGCGCAGGCCCTCTCCCGTG 0: 1
1: 0
2: 3
3: 16
4: 215
Right 1077896408 11:6456754-6456776 TTCGTGTGCAGTGGCGCTCGTGG 0: 1
1: 0
2: 0
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077896399 Original CRISPR CACGGGAGAGGGCCTGCGCC AGG (reversed) Exonic
900170855 1:1268051-1268073 GGCGGGAGTGGGGCTGCGCCAGG - Intronic
900185255 1:1330410-1330432 CCCCTGGGAGGGCCTGCGCCTGG + Intergenic
900953967 1:5875514-5875536 CACAGGAGAGGACATGCCCCCGG + Intronic
901810932 1:11766467-11766489 CACGGGATGGGGCCTGAGTCTGG - Exonic
901839433 1:11944756-11944778 CAGGGCAGAGGGCTGGCGCCAGG - Intronic
902362461 1:15949660-15949682 CACAGGGGAGTGCCTGAGCCGGG - Intronic
902759205 1:18570028-18570050 CCCAGGAGAGGGCCTGCGCCTGG - Intergenic
903644532 1:24886567-24886589 AATGGGAGAGGTCCTGGGCCTGG - Intergenic
904619027 1:31764379-31764401 CCCGGGAGGGGGCGCGCGCCGGG + Intronic
904702097 1:32363776-32363798 GACGGAAGAGGGCCTTGGCCCGG - Exonic
904847150 1:33429132-33429154 CAAGGGAGAGGGCCTGAAACTGG - Intronic
905182671 1:36176535-36176557 CACCGGAGCGGGGCTGCCCCCGG - Exonic
906038357 1:42767030-42767052 CCCGGGGGCGGGCCTTCGCCGGG - Intronic
907438629 1:54464970-54464992 CACAGGGGAGGGCCCGCCCCAGG + Intergenic
910866103 1:91789435-91789457 CCCGGCAGAGGGACTGAGCCTGG - Intronic
910930936 1:92441991-92442013 CACGGGAGAGGGGCGGGGCCGGG + Intergenic
911196447 1:94999896-94999918 GAGGAGAGATGGCCTGCGCCAGG - Intronic
914098560 1:144564836-144564858 CAGGGGTGAGGGGCTGCGCCCGG - Intergenic
914300424 1:146372807-146372829 CAGGGGTGAGGGGCTGCGCCCGG + Intergenic
915167810 1:153958327-153958349 CCCGGGTGAGGGGCCGCGCCGGG - Exonic
915333318 1:155126755-155126777 CGGGGGAGGGGGCCTGAGCCGGG + Intergenic
915736558 1:158089004-158089026 GAAGGGAGAGGGCCTGGGGCGGG + Intronic
916506077 1:165429153-165429175 GAGGGGAGAGGGCCTGCTCTAGG + Intronic
920237128 1:204515607-204515629 CAGGGGAGAGCCACTGCGCCCGG + Intergenic
920303377 1:205003145-205003167 CAGGGGATAGGGCCAGCGCAGGG + Intronic
922738278 1:228001445-228001467 CAGGGGTGAGCCCCTGCGCCTGG - Intergenic
923218513 1:231872021-231872043 CACGGCTGAGGGCCTCTGCCTGG - Intronic
923305502 1:232684661-232684683 GACGGGAGAGGGACAGAGCCAGG - Intergenic
1062918964 10:1265627-1265649 CCCGGAAGACGGCCTGAGCCAGG + Intronic
1062918985 10:1265695-1265717 CCCGGAAGACGGCCTGAGCCAGG + Intronic
1062919008 10:1265763-1265785 CCCGGAAGACGGCCTGAGCCAGG + Intronic
1062919034 10:1265831-1265853 CCCGGAAGACGGCCTGAGCCAGG + Intronic
1062919060 10:1265899-1265921 CCCGGAAGACGGCCTGAGCCAGG + Intronic
1062919107 10:1266035-1266057 CCCGGAAGACGGCCTGAGCCAGG + Intronic
1062919129 10:1266102-1266124 CCCGGAAGACGGCCTGAGCCAGG + Intronic
1066672729 10:37857581-37857603 CGGGGGAGAGCGACTGCGCCAGG - Exonic
1067713925 10:48672181-48672203 CCTGGGAGAGGCCCTGCGCGGGG - Intergenic
1067769889 10:49115512-49115534 CGCGGGAGAGCGCCGCCGCCTGG + Intergenic
1070933731 10:80278032-80278054 CATGAGAGAGGCCCTGGGCCAGG - Intronic
1071065692 10:81633211-81633233 CACTGGAGAGGGCCAAAGCCAGG + Intergenic
1072704088 10:97667485-97667507 CAGGCGTGAGGCCCTGCGCCCGG + Intronic
1073615668 10:104992189-104992211 CATGTGAGAGGCCCTGAGCCTGG + Intronic
1073783194 10:106861612-106861634 CAGGTGTGAGGGACTGCGCCCGG - Intronic
1074169409 10:110918697-110918719 CACGGGGGCGGGCCGCCGCCAGG + Intronic
1075857019 10:125638204-125638226 CACGGGGAGGGGCCTGCACCTGG - Intronic
1076833782 10:133009822-133009844 CACGGGGCAGGGCCTGGGGCAGG + Intergenic
1076856420 10:133117496-133117518 CCCGGGAGACTGCCTGGGCCAGG + Intronic
1076895258 10:133308514-133308536 GACGGGAGAGGGCGTGCGAGAGG + Exonic
1077896399 11:6456723-6456745 CACGGGAGAGGGCCTGCGCCAGG - Exonic
1078348574 11:10573622-10573644 GGTGGGAGAGGGCCTGTGCCTGG + Exonic
1078672475 11:13377241-13377263 CTCGGGAGAGAGACTGGGCCAGG - Intronic
1078861958 11:15256763-15256785 CACGGGTGAGGCACTGCACCTGG + Intergenic
1081714031 11:45235916-45235938 CATGGGGGCGGGCCTGAGCCTGG - Intergenic
1081914998 11:46725045-46725067 CAGGGGTGAGGCACTGCGCCCGG + Intronic
1082069933 11:47931090-47931112 CCCGGGAGAGGGACTGCCACTGG + Intergenic
1082187309 11:49199631-49199653 CACGTGTGAGGCACTGCGCCTGG - Intronic
1083429347 11:62605863-62605885 CAGGGGAGAAGCCCTGGGCCAGG + Exonic
1083635398 11:64118021-64118043 CCCGGGAGAGGGCCTACAACCGG + Exonic
1083849242 11:65355461-65355483 GACGGGGGAGGGCCTGGGACTGG - Intronic
1084207692 11:67605465-67605487 CAAGAGAGGGGGCCTGCGGCTGG + Intronic
1085353561 11:75815838-75815860 CGAGGGAGAGGGTCTGCGCGGGG - Intronic
1094855383 12:34400571-34400593 CACGGCAGAGGTCCTGCCCACGG + Intergenic
1096478374 12:51922460-51922482 CAGGGGTGTGGGCCTGAGCCAGG - Intronic
1097232803 12:57522688-57522710 GACGGGAGAGGGGCGGGGCCGGG - Intronic
1098092725 12:66921318-66921340 CACAGGAAAGGGACTGCTCCTGG + Intergenic
1102502265 12:113360521-113360543 CACAGCAGAGGGGCTGAGCCTGG - Intronic
1105522099 13:21140462-21140484 CACGGAAGTGCGCCTGCGCCAGG + Intergenic
1106004365 13:25755245-25755267 CAGTGGAGAGGGCCTGCCTCTGG - Intronic
1106639896 13:31573050-31573072 CACGGGAGAGGTCCTGAGACTGG + Intergenic
1110450761 13:75636023-75636045 CCCGGGAGAGGGCAGGGGCCAGG + Intronic
1114131630 14:19799916-19799938 CACGGGAGATCTCCTGTGCCAGG - Intronic
1122629391 14:103100375-103100397 CCCGGGAGAAGGCCTGCCTCAGG - Exonic
1122772549 14:104103816-104103838 CAGGGGACAGGGCCTGGGGCTGG - Intronic
1123574695 15:21655621-21655643 CACGGGAGATCTCCTGTGCCAGG - Intergenic
1123611309 15:22098117-22098139 CACGGGAGATCTCCTGTGCCAGG - Intergenic
1123675006 15:22702188-22702210 CAGGCGTGAGGCCCTGCGCCCGG - Intergenic
1123763032 15:23447039-23447061 CATGGGAGGGGGCCTGGGGCTGG + Intronic
1124327019 15:28775177-28775199 CAGGCGTGAGGCCCTGCGCCCGG - Intergenic
1127152733 15:56094779-56094801 CACGGGAGAGCCCTTGCTCCAGG - Exonic
1128179755 15:65591633-65591655 CATGGGAGAGGTTCTGGGCCAGG + Exonic
1128738338 15:70066185-70066207 CATGGGAGAGGTGCTGCGCCTGG + Exonic
1129880484 15:79003445-79003467 CAGAGGACAGGGCCTGGGCCAGG - Intronic
1132301529 15:100779131-100779153 CTCGGGAGAGGGCGAGCACCTGG - Intergenic
1202983560 15_KI270727v1_random:389873-389895 CACGGGAGATCTCCTGTGCCAGG - Intergenic
1133221001 16:4319116-4319138 CATGGGAGAGGCCCTGTGCTGGG + Intronic
1133221833 16:4322174-4322196 CAAAGGAGAGGGCCTGGGGCAGG + Intronic
1134550448 16:15136328-15136350 TACGGGAGGTGGCCTGCGCGGGG - Intronic
1135691387 16:24540136-24540158 GAGGGGAGAGGGCCTAGGCCCGG - Intronic
1138685103 16:58718228-58718250 CACGGGAGTGGACCCGCGTCCGG - Exonic
1139199771 16:64962547-64962569 CACGGGAGAGGTCCTGTGACTGG - Intronic
1139960849 16:70716481-70716503 TACGGAGGAGGGCCTGGGCCAGG - Intronic
1140478523 16:75250781-75250803 CGCGGGAGGGGGCCAGGGCCGGG - Intronic
1141991598 16:87614041-87614063 CAAGGGAGGGGCCCTGCCCCAGG + Intronic
1142895591 17:2975729-2975751 CATGGGAGGGGGCTTGCCCCTGG + Intronic
1148534746 17:48430045-48430067 CACTGGAGGGGGCCTGCGCCAGG + Intronic
1150648637 17:66995572-66995594 CAGGGGTGAGCCCCTGCGCCCGG - Intronic
1152044866 17:77929274-77929296 GACTGGAGAGGACCTGCGTCAGG - Intergenic
1152105383 17:78325591-78325613 CACGGCGGAGAGCCTGCCCCAGG + Intergenic
1152210926 17:79002853-79002875 CCTGGGAGAGGTCCTGCTCCTGG - Intronic
1152357268 17:79813319-79813341 CCCGGGAGGGTCCCTGCGCCCGG + Intergenic
1152568677 17:81111737-81111759 GAGGGCAGAGGGCCTGCTCCTGG - Intronic
1152642336 17:81454465-81454487 CTCCTGAGAGGGCCTGAGCCCGG + Intronic
1154300850 18:13191166-13191188 CCCGGGAGAGACCCTCCGCCTGG - Intergenic
1157109849 18:44810270-44810292 CAGGAAGGAGGGCCTGCGCCAGG - Intronic
1158843924 18:61420608-61420630 CAGGGGAGAGGTGCTGTGCCTGG + Intronic
1160100440 18:75915961-75915983 CAGAGGAGCGGGCCTGGGCCGGG - Intergenic
1160125457 18:76167661-76167683 CACGGGAGGGCGCCTGTGGCTGG - Intergenic
1160661948 19:305445-305467 CACGGGCGAGGGGGTGCACCGGG - Intergenic
1161398775 19:4058627-4058649 CTGGGGAGAGGGCCTGAGCTGGG + Intronic
1161408348 19:4102733-4102755 CACGGCAGAGGCTCTGCTCCGGG + Intronic
1163007929 19:14408005-14408027 CCCGGGTAAGGGGCTGCGCCTGG + Exonic
1163489704 19:17609885-17609907 CAAGGGAGGGGGCATCCGCCAGG - Intronic
1164630088 19:29756248-29756270 TAGGGGAGAGGGCAGGCGCCAGG + Intergenic
1165360327 19:35332613-35332635 CCTGGGAGGGGGCCTGCGTCTGG + Exonic
1165448202 19:35868406-35868428 CCCGGGCGGGAGCCTGCGCCAGG - Intronic
1166791731 19:45402757-45402779 CAGGGGAGAGTACCTGCGGCTGG - Intronic
1166878878 19:45914718-45914740 CACAGGAGAGGGGCTGGGGCTGG + Exonic
1168404001 19:56101355-56101377 CTCCGGGGAGGGCCTGCGCTTGG - Intronic
926700468 2:15800044-15800066 CAGGGGAGAGGGCAGGTGCCTGG + Intergenic
927201398 2:20580172-20580194 CAAGGCTGAGGGCCTGCCCCTGG + Intronic
928991069 2:37233239-37233261 CTAGGGAGAGGGCCTACACCAGG + Intronic
929599220 2:43194515-43194537 CACGGGCCAGGGCCAGGGCCAGG - Intergenic
930071425 2:47369440-47369462 CTCGCGGGAGGGCGTGCGCCGGG - Exonic
932187943 2:69714623-69714645 CATGGGAGAGGGCCTGCGTTGGG + Intronic
935259849 2:101344627-101344649 CCCTGGAGATGGCCTGCTCCAGG + Intergenic
936234630 2:110732544-110732566 AGAGGGAGAGGGCGTGCGCCTGG + Intergenic
944238777 2:197465580-197465602 CAGGGGAGAGAGGCTGGGCCTGG - Intronic
944651003 2:201830216-201830238 CACGTGTGAGTCCCTGCGCCTGG + Intronic
946396525 2:219446146-219446168 CAGGGGAGAGGGCCAGGGCTGGG + Intronic
1171187352 20:23132350-23132372 CCCAGGAGAGGGCCGGGGCCTGG + Intergenic
1172550048 20:35791988-35792010 CAGTGGAAAGGGCCTGTGCCAGG - Intronic
1173222535 20:41141532-41141554 CACGGGAGAGGGCAAGGCCCAGG + Intronic
1176124329 20:63468730-63468752 CACCGGGGAGGGCCTGTCCCTGG - Intronic
1176770690 21:13069973-13069995 CACGGGAGGGGGTATGTGCCAGG + Intergenic
1177166901 21:17613101-17613123 CGCGGTCGAGGGTCTGCGCCAGG - Intergenic
1179419204 21:41222472-41222494 CAGGGGAAAGGCCCTGCCCCTGG + Intronic
1179792245 21:43762467-43762489 GATGGGAGGGGGCCTGGGCCCGG - Intergenic
1180050225 21:45327681-45327703 CAGGGGAGTGGGCCTGGGCCAGG + Intergenic
1180622515 22:17171590-17171612 CACGGGAGTGGGCCCGGGCGCGG + Intergenic
1180981329 22:19879488-19879510 CAAGGGTGAGTGCCTGAGCCTGG + Intronic
1180997682 22:19973524-19973546 CAAGCGAGAGGGCCGGGGCCTGG + Intronic
1181317869 22:21982601-21982623 CTCGGGAGAGCGCCCGGGCCGGG - Exonic
1183367167 22:37412887-37412909 CCCAGGAGTGGGCCTGGGCCAGG + Intronic
1183558327 22:38549342-38549364 CAGGGGTGAGCGACTGCGCCTGG - Intronic
1185058064 22:48591602-48591624 GACAGGAGAGAGCCTGCTCCAGG + Intronic
1185128058 22:49022701-49022723 CACAGGGGAGGGCCTTGGCCTGG + Intergenic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
949987870 3:9553863-9553885 CTCGGGAGCGCGCCTCCGCCGGG - Intergenic
953916679 3:46924995-46925017 CAGGGGAGAGGGCCTGGCCCAGG - Intronic
956177158 3:66483827-66483849 CAGAGGAGAGCGCCTGAGCCTGG + Intronic
961365764 3:126398296-126398318 GTCAGGAGAGGGCCTGCGGCTGG + Intronic
962350242 3:134651047-134651069 CACGGGAGAGGGCGAGGGCGCGG + Intronic
963091515 3:141487324-141487346 CCCGGGAGGGGGCCTGGGCCGGG + Intronic
967888945 3:194351412-194351434 GACGGGAGAGGGCCTTGGCAAGG + Intergenic
968467110 4:758310-758332 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467138 4:758416-758438 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467195 4:758623-758645 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467209 4:758676-758698 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467238 4:758782-758804 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467252 4:758835-758857 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467267 4:758888-758910 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467282 4:758941-758963 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467296 4:758994-759016 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467311 4:759047-759069 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467326 4:759100-759122 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467341 4:759153-759175 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467356 4:759206-759228 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467371 4:759259-759281 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467385 4:759312-759334 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467400 4:759365-759387 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467415 4:759418-759440 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467430 4:759471-759493 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467445 4:759524-759546 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467460 4:759577-759599 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467475 4:759630-759652 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467490 4:759683-759705 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467504 4:759736-759758 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467519 4:759789-759811 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467534 4:759842-759864 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968467549 4:759895-759917 CTCGGGAGAGGGGCCGCGCGGGG - Intronic
968551173 4:1223996-1224018 CCGGGGATAGGGCCAGCGCCAGG + Intronic
968653370 4:1768579-1768601 CACAGGGGATGGCCTGGGCCGGG + Intergenic
968680655 4:1916617-1916639 CAGGCGTGAGGGACTGCGCCTGG + Intronic
969241052 4:5897906-5897928 CACGGGAGTGGTCCAGCGACAGG - Intronic
978777029 4:112515181-112515203 CTCGGGAGACGGCCCGCGCCCGG + Exonic
983210310 4:164951912-164951934 TATGGCAGAGGGCCTGCGTCTGG - Intergenic
983550181 4:169009809-169009831 AACGGGAGAGCGCCTGCACGCGG + Intronic
985728051 5:1525959-1525981 CACTAGAGAGGACCTGCTCCAGG - Intergenic
985783815 5:1883940-1883962 CAGGGGAGGGCGCCTCCGCCAGG - Intronic
988977424 5:36528864-36528886 CATGGGAGAAGGCCTTCTCCAGG - Intergenic
992507711 5:77404403-77404425 CAGGTGTGAGGCCCTGCGCCCGG + Intronic
997284302 5:132667527-132667549 CAGGGGAGAGGGCAGGCGGCGGG - Intergenic
1001246839 5:170111293-170111315 AATGGGTGAGGGCCTGGGCCAGG + Intergenic
1002467477 5:179414875-179414897 CATGGAAGAGGCCCTGTGCCTGG - Intergenic
1002538638 5:179892106-179892128 AAGGGGTGAGGGCCTGGGCCAGG - Intronic
1002915387 6:1524450-1524472 CCAGGAAGAGGACCTGCGCCAGG - Intergenic
1005919987 6:30392719-30392741 CAGGGGTGAGGGACTGCGCCGGG + Intergenic
1006372705 6:33655313-33655335 CACTGGATAGGGGCTGCCCCTGG + Intronic
1006919643 6:37619051-37619073 CAGGGCAGAGGGGCTGCTCCAGG + Intergenic
1018852943 6:167654241-167654263 CTCAGGAGAGGGCCTGTCCCAGG - Intergenic
1019397693 7:830996-831018 CACAGGACAGGGCCTTGGCCTGG - Intronic
1020042271 7:5013040-5013062 CATGGGAGAGGGCCTGCGTTGGG + Intronic
1022528454 7:31052816-31052838 AGCGGGCGAGGGCCGGCGCCAGG + Intronic
1025739541 7:64183935-64183957 AGCGGGAGAGGGCCTGGGCAGGG - Intronic
1027540078 7:79454476-79454498 CGCGGGCGGGGGCCTGCCCCGGG - Intergenic
1031970513 7:128061686-128061708 CACAGAAGAGGGCATGGGCCAGG + Intronic
1032457273 7:132082973-132082995 CACGGCAGAGTGGCTGAGCCAGG + Intergenic
1034338221 7:150337005-150337027 CCTGGGAGAGTGCCTGGGCCTGG + Exonic
1035316093 7:157998168-157998190 CAAGGGAGAGGCCCAGGGCCCGG + Intronic
1036695787 8:10974288-10974310 CACCTGAGAGGGCCTGTGCCTGG + Intronic
1037535173 8:19817181-19817203 CGCGGGAGCGGGCAGGCGCCAGG - Exonic
1038191382 8:25324196-25324218 CACGGGAGAGGTCCTGTGAATGG + Intronic
1038798196 8:30727709-30727731 CACGGGAGAGGGCGCGCGTGAGG + Exonic
1043527497 8:81112211-81112233 CACGGGTGAGGACCGGCGCGGGG + Intergenic
1043560535 8:81488375-81488397 CAAGGCAGACGGCCTGAGCCAGG - Intergenic
1049149762 8:141027070-141027092 CATGGTAGAGGCCCTGGGCCTGG - Intergenic
1049819006 8:144622860-144622882 CAGGGGAGAGAGGCTGGGCCAGG + Intergenic
1049843195 8:144787211-144787233 CGCAGGGGAGGGTCTGCGCCGGG + Intronic
1052784293 9:32814296-32814318 CACGGGTGAGCTGCTGCGCCTGG - Intergenic
1054764982 9:69035839-69035861 CCCGGGTGAGGGTCTGGGCCTGG - Exonic
1057496905 9:95568589-95568611 CCCAAGAGAGGGCCAGCGCCAGG - Intergenic
1057817051 9:98303605-98303627 GAGGGGAGGGGGCCTGCCCCAGG - Intronic
1060667966 9:125444322-125444344 CAGGGGTGAGTGCCTGTGCCAGG - Intronic
1060984845 9:127813983-127814005 GAAGGGAGAGGGCCTCTGCCTGG + Exonic
1061274158 9:129559758-129559780 CATGGGAGAGGCCCTGCTGCAGG - Intergenic
1062389150 9:136327297-136327319 CAGGGGAGAGGGCCTGGGCCTGG - Intergenic
1062410665 9:136422562-136422584 CACGGGACAGGGCAAGTGCCCGG - Intronic
1062428819 9:136517950-136517972 CACGGGTGAGAGGCTGCTCCAGG + Intronic
1203787711 EBV:136993-137015 CACGCTACAGGCCCTGCGCCGGG + Intergenic
1185628684 X:1500723-1500745 CAGGCGAGAGGCCCTGCGCCCGG + Intronic
1190274527 X:48891559-48891581 CGCGGGAGAGGGGCGGGGCCTGG + Intergenic
1190569613 X:51768223-51768245 CACAGGAGAGGGCCTGAGTGTGG - Intergenic
1190706150 X:53029949-53029971 TAGGGGAAAGGGCCTGCACCCGG + Intergenic
1196791561 X:119469016-119469038 CCCGGGGGAGGCCATGCGCCCGG + Intronic
1198370560 X:135985413-135985435 CACGGGAAAGGGGCGGGGCCCGG - Intergenic