ID: 1077898749

View in Genome Browser
Species Human (GRCh38)
Location 11:6473750-6473772
Sequence GGAATACAAACGCACCCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077898735_1077898749 15 Left 1077898735 11:6473712-6473734 CCCACCCACAGACGCTCCGACCC 0: 1
1: 0
2: 0
3: 5
4: 148
Right 1077898749 11:6473750-6473772 GGAATACAAACGCACCCTTGGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1077898734_1077898749 16 Left 1077898734 11:6473711-6473733 CCCCACCCACAGACGCTCCGACC 0: 1
1: 0
2: 0
3: 9
4: 178
Right 1077898749 11:6473750-6473772 GGAATACAAACGCACCCTTGGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1077898741_1077898749 -1 Left 1077898741 11:6473728-6473750 CCGACCCAGACCCGGGCTGACAG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 1077898749 11:6473750-6473772 GGAATACAAACGCACCCTTGGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1077898733_1077898749 17 Left 1077898733 11:6473710-6473732 CCCCCACCCACAGACGCTCCGAC 0: 1
1: 0
2: 0
3: 9
4: 199
Right 1077898749 11:6473750-6473772 GGAATACAAACGCACCCTTGGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1077898738_1077898749 10 Left 1077898738 11:6473717-6473739 CCACAGACGCTCCGACCCAGACC 0: 1
1: 0
2: 0
3: 13
4: 114
Right 1077898749 11:6473750-6473772 GGAATACAAACGCACCCTTGGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1077898737_1077898749 11 Left 1077898737 11:6473716-6473738 CCCACAGACGCTCCGACCCAGAC 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1077898749 11:6473750-6473772 GGAATACAAACGCACCCTTGGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1077898744_1077898749 -6 Left 1077898744 11:6473733-6473755 CCAGACCCGGGCTGACAGGAATA 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1077898749 11:6473750-6473772 GGAATACAAACGCACCCTTGGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1077898743_1077898749 -5 Left 1077898743 11:6473732-6473754 CCCAGACCCGGGCTGACAGGAAT 0: 1
1: 0
2: 2
3: 8
4: 85
Right 1077898749 11:6473750-6473772 GGAATACAAACGCACCCTTGGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1077898736_1077898749 14 Left 1077898736 11:6473713-6473735 CCACCCACAGACGCTCCGACCCA 0: 1
1: 0
2: 1
3: 4
4: 160
Right 1077898749 11:6473750-6473772 GGAATACAAACGCACCCTTGGGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077898749 Original CRISPR GGAATACAAACGCACCCTTG GGG Intronic
912117068 1:106419578-106419600 GGATGACAAACACACCCCTGTGG - Intergenic
921986561 1:221318711-221318733 GGAATACAGGAGCTCCCTTGGGG + Intergenic
923011977 1:230095438-230095460 GGAATTCAGACCCACCCCTGCGG + Intronic
923795760 1:237153785-237153807 CCAATACAAACACAGCCTTGGGG - Intronic
1062950295 10:1494507-1494529 GGACTACAACAGCACTCTTGGGG + Intronic
1063915285 10:10875922-10875944 GGAATATAAATGCACCATTAAGG - Intergenic
1073192442 10:101661361-101661383 GGAATTGAAACCCACCCCTGTGG + Intronic
1077898749 11:6473750-6473772 GGAATACAAACGCACCCTTGGGG + Intronic
1079031175 11:16987461-16987483 CGAGTAGAGACGCACCCTTGAGG + Intronic
1084471120 11:69359444-69359466 GGGATACTAACGCACCCTACAGG + Intronic
1089738334 11:120564682-120564704 GGAATACTAATGCACCCTAAAGG + Intronic
1090255944 11:125284379-125284401 GGAGTAAAGGCGCACCCTTGAGG - Intronic
1096170053 12:49460677-49460699 GAAATACAAAAGAAACCTTGTGG + Intronic
1100875825 12:98960232-98960254 GGATCACACAAGCACCCTTGTGG - Intronic
1104124296 12:125831118-125831140 GAAATAGAAACGCACTCATGCGG - Intergenic
1110634354 13:77748708-77748730 GGAATACAAAGGCAATCTTCTGG + Intronic
1112659828 13:101495402-101495424 GGAACAGAAAAGCACCCTTGTGG - Intronic
1113211842 13:107992812-107992834 GGTAAACAAAGGCACCCCTGTGG + Intergenic
1117217094 14:53561940-53561962 GGAATACAAAAGATCCCTTAAGG + Intergenic
1118839447 14:69500035-69500057 GGACAACAAGAGCACCCTTGGGG - Intronic
1129302409 15:74633023-74633045 GGAAAACAAAGACACCCTTGGGG - Intronic
1137936393 16:52638965-52638987 GGAATATAATGGCAGCCTTGGGG + Intergenic
1140073043 16:71669636-71669658 GCAATAGAAAAGCACACTTGTGG + Intronic
1140717735 16:77741845-77741867 GGAAAAAAAACCCACCTTTGAGG + Exonic
1141620781 16:85235653-85235675 GGAATCCAACCCCACCCTCGGGG - Intergenic
1158862057 18:61602357-61602379 GAAATACACAAGCACTCTTGAGG + Intergenic
1161931142 19:7341190-7341212 GGAAAAAAAACCGACCCTTGTGG - Intergenic
1168725801 19:58581305-58581327 GGAACACAAGCACCCCCTTGCGG + Intergenic
938531406 2:132191074-132191096 GGAGTACAAAAGAACCTTTGAGG - Intronic
938591647 2:132743223-132743245 GGAATACAAACATAGCCTGGAGG + Intronic
942243719 2:173988022-173988044 GTAAAACAAACTCACCCTAGTGG - Intergenic
947057704 2:226125675-226125697 GGAACACAAAAACACCCTTAAGG - Intergenic
1173328624 20:42055709-42055731 GGAATAGAAAGGCATCCTGGAGG + Intergenic
1176765053 21:13008355-13008377 GGAATACAAAAGAACTTTTGAGG + Intergenic
1177741507 21:25159500-25159522 GGAATAGAAAAGAACCCTTCAGG + Intergenic
1182073799 22:27481001-27481023 GGAGTACAACCATACCCTTGGGG - Intergenic
956624971 3:71258188-71258210 GAAATACAAACACACACTTGTGG + Intronic
960862639 3:122167745-122167767 GGATGACACAAGCACCCTTGTGG + Intergenic
964063805 3:152557450-152557472 TGAAAACAAACTCACTCTTGTGG + Intergenic
965118218 3:164519495-164519517 GTGATACAATTGCACCCTTGTGG + Intergenic
966695304 3:182784084-182784106 AGAATTCTAACGCAACCTTGTGG + Intergenic
968447593 4:660087-660109 TGAATACAAAGGCACCGGTGTGG - Intronic
979297249 4:119047687-119047709 ATAAAACAAACGCTCCCTTGAGG - Intronic
984946901 4:184975876-184975898 GGAATAAGAACCCACCCTTCCGG + Intergenic
992531672 5:77658705-77658727 GGGTAACAAAAGCACCCTTGTGG + Intergenic
1000168606 5:158679476-158679498 GGAATTAAAGCTCACCCTTGGGG - Intergenic
1003842914 6:10140767-10140789 GGAATAAAAAGTCACTCTTGGGG - Intronic
1009770128 6:68135073-68135095 GGAATACAAGAGAACCCTTAGGG - Intergenic
1010502301 6:76615646-76615668 GGATGACACAAGCACCCTTGTGG - Intergenic
1013651869 6:112203105-112203127 GAAACAAAAACGAACCCTTGAGG - Intronic
1014036361 6:116770765-116770787 AGAATACAAAAGCAGCCCTGAGG + Intergenic
1020048378 7:5061845-5061867 GGAATACAATGGCACCATTTTGG - Intronic
1021914858 7:25421338-25421360 GGAATGCAAACACAGCATTGAGG - Intergenic
1024541909 7:50481696-50481718 GGAACACAAATTCAGCCTTGTGG - Intronic
1027610319 7:80352147-80352169 GGAATACAGGCGAACCCTTAGGG - Intergenic
1031461248 7:122052165-122052187 GGAACACAAACTCACCATTTAGG + Intronic
1038599520 8:28925601-28925623 GAAATACAGACTCAGCCTTGAGG + Intronic
1048204675 8:132405835-132405857 AGAATAAAAAGGCACCCTAGAGG + Intronic
1051187811 9:14479216-14479238 GGCACAGAAAAGCACCCTTGTGG + Intergenic
1055768732 9:79693022-79693044 GGAATACACATGCACTCATGAGG - Intronic
1060424682 9:123494343-123494365 GGAATACACCCGCACCCTCTTGG + Intronic
1062331290 9:136046008-136046030 GGAATGCAGCCGCACCCTGGGGG + Intronic
1188286860 X:28337340-28337362 GGAATACACACACACACTAGCGG + Intergenic