ID: 1077900642

View in Genome Browser
Species Human (GRCh38)
Location 11:6484951-6484973
Sequence GAGGAAGACCAGATTATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077900642_1077900648 15 Left 1077900642 11:6484951-6484973 CCTTCCATAATCTGGTCTTCCTC 0: 1
1: 0
2: 2
3: 30
4: 262
Right 1077900648 11:6484989-6485011 GTGATAGCCATTGGCATAATCGG 0: 1
1: 0
2: 2
3: 3
4: 76
1077900642_1077900646 6 Left 1077900642 11:6484951-6484973 CCTTCCATAATCTGGTCTTCCTC 0: 1
1: 0
2: 2
3: 30
4: 262
Right 1077900646 11:6484980-6485002 TACCATAAAGTGATAGCCATTGG 0: 1
1: 0
2: 0
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077900642 Original CRISPR GAGGAAGACCAGATTATGGA AGG (reversed) Intronic
902373318 1:16018396-16018418 GAGGAGAACCAGAGTCTGGAGGG - Exonic
903705113 1:25279986-25280008 GCGGGAGCCCAGATAATGGATGG + Intronic
903722112 1:25413335-25413357 GCGGGAGCCCAGATAATGGACGG - Intronic
906348705 1:45038557-45038579 GAGGTAGAACAGAGTCTGGAAGG + Intronic
906784448 1:48602373-48602395 CAGGAAGATGAGATTTTGGAAGG - Intronic
908303540 1:62786834-62786856 GAGGAAGAACTGATTACAGAGGG + Intronic
909158543 1:72114224-72114246 GAGGTTGACCATATTATGGAGGG - Intronic
909758592 1:79260596-79260618 GAGGTAGACCAGAATGAGGAAGG + Intergenic
911212458 1:95156777-95156799 GAGGAAGACGACACCATGGAAGG + Intronic
912949265 1:114109484-114109506 TAGGAAGCCAAGATTATGAAAGG - Intronic
916307700 1:163357915-163357937 GAGAAAGTCTAGATTATGAAGGG - Intergenic
916559922 1:165925788-165925810 GAGGAAGAGGAGATTAAGAATGG + Intergenic
916670977 1:167019943-167019965 GTAGAAGACAAGATTATTGAAGG - Intronic
917159301 1:172039774-172039796 GAGGAAGAACAGAGAAAGGAAGG - Intronic
918128083 1:181601855-181601877 GTGGAAGAGCAGATCATGGAGGG - Intronic
919117773 1:193302482-193302504 TAGGAAGAGCTGACTATGGAAGG + Intergenic
919408218 1:197210333-197210355 GAGGCCTACCACATTATGGAGGG - Intergenic
920080804 1:203371626-203371648 GAGGAGGAGCAGATTATGAAAGG - Intergenic
922651906 1:227347748-227347770 TGGGAAGACCAGTTTATGGCTGG - Intergenic
923398780 1:233595146-233595168 GAGGTCTACCACATTATGGAGGG + Intergenic
924646140 1:245878681-245878703 GAGGAAGCCCAGCTGAGGGAAGG + Intronic
1063640220 10:7822014-7822036 GAGTGAGATCAGGTTATGGAAGG + Intronic
1063841694 10:10079742-10079764 GAAGAAGGGCAGGTTATGGATGG + Intergenic
1064119821 10:12609041-12609063 CAGGAAGACCAGAACCTGGAAGG - Intronic
1064163592 10:12967010-12967032 GAGGAAGCCCAGAAGATGAAGGG - Intronic
1065817024 10:29491641-29491663 GTGGAAAACCAGACTAGGGAAGG + Intronic
1066353664 10:34661681-34661703 GATGAAGGCCAGATGATGGATGG - Intronic
1067232493 10:44421881-44421903 GAGGAGGACCAGAACAGGGAGGG + Intergenic
1067245436 10:44537771-44537793 GAGGAAGAGAACATGATGGAGGG - Intergenic
1067898857 10:50216638-50216660 GGGCAAGTCCAGATTGTGGATGG - Intronic
1068277367 10:54818602-54818624 GAGGAAGTCCAAATTATGCCAGG + Intronic
1069556186 10:69400104-69400126 GAGGAAGATGAGATTTTGCAGGG - Intronic
1070821913 10:79361158-79361180 GAGGCCCACCACATTATGGAGGG + Intergenic
1071346904 10:84701809-84701831 AAGTAAGACCAGATGATGGGTGG + Intergenic
1073824101 10:107300600-107300622 GAAGAAGGACAGTTTATGGAGGG - Intergenic
1074384013 10:113003076-113003098 GAGGCAGGCCTGATTATGTATGG + Intronic
1074914681 10:117943872-117943894 AAGGATGACCAGAATATAGAAGG - Intergenic
1075155256 10:119970978-119971000 GAGGGAGAACAGATAATGAAAGG - Intergenic
1076139264 10:128066451-128066473 GAGGAAGACCAGTCATTGGAGGG + Intronic
1077089248 11:771004-771026 GAGGAAGAGCAGGTTCTGCACGG + Exonic
1077280498 11:1742872-1742894 GAGGATGAACAGATGATGGATGG + Intronic
1077732287 11:4744878-4744900 GAAGAAGAGGTGATTATGGAAGG - Intronic
1077900642 11:6484951-6484973 GAGGAAGACCAGATTATGGAAGG - Intronic
1078144810 11:8715496-8715518 GAAGCAGTCCAGATTAGGGAAGG + Intronic
1078729023 11:13959238-13959260 CAGTGAGACCAGATTGTGGATGG + Intergenic
1078865555 11:15293974-15293996 GTAAAAGACCAGATTGTGGAGGG + Intergenic
1079370552 11:19848440-19848462 GAGGAGGACCAGAGAAAGGAGGG - Intronic
1082676071 11:56104536-56104558 GAGGAAAAAAAGAGTATGGAAGG - Intergenic
1082965449 11:58962362-58962384 CAGGAAGAGAAGATGATGGAGGG + Intronic
1082986913 11:59177037-59177059 GAGGAAGAGCTGGTTTTGGAGGG - Intronic
1084192798 11:67506415-67506437 GGGGAAGAGGAGACTATGGATGG - Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1084867151 11:72068321-72068343 GAGAAAGACCAGTTTTTGGCAGG + Intronic
1086011562 11:82109992-82110014 GATGAATATCAGATTATGGGTGG - Intergenic
1086160205 11:83713523-83713545 GATGAAAACCAGATCATGGAAGG + Intronic
1086507862 11:87524711-87524733 GTGGAAAAACAGGTTATGGAAGG - Intergenic
1087790945 11:102406021-102406043 GAAGAAGACCAGAGTTGGGATGG - Intronic
1087961683 11:104358513-104358535 GTGGAAGAACAGATTATTTAAGG - Intergenic
1089188151 11:116635091-116635113 GGATAAGACTAGATTATGGAGGG - Intergenic
1090644121 11:128753803-128753825 TGGGAAGACCAGAGTAGGGACGG - Intronic
1091465349 12:679027-679049 GAGGAAGAACTGCTGATGGAAGG - Intergenic
1091750805 12:3020359-3020381 GAGCAAGACTGGATTCTGGAGGG - Intronic
1092377798 12:7970138-7970160 GAGAAAGACAAGATTGGGGATGG - Intergenic
1093048453 12:14480395-14480417 GAGGAATACCAGAGTAGAGAAGG + Intronic
1094108375 12:26836244-26836266 GAAGGAGACCAGATCATGGATGG - Intergenic
1095251922 12:39989143-39989165 GCAGAAGACCAGATTATGTAGGG - Intronic
1095850040 12:46792387-46792409 GAGGAGGAGCAGGTTTTGGAGGG + Intronic
1095909272 12:47409381-47409403 GAGGGAGGTCAGATCATGGAGGG - Intergenic
1097790156 12:63806962-63806984 GTGGAAGCCCAGATTATTGGAGG - Intronic
1097939817 12:65291787-65291809 GAAGAAGACCAGATTATATGGGG + Intronic
1100064562 12:90626295-90626317 GAGGAATACCAGACTATGGGAGG + Intergenic
1101258764 12:103007352-103007374 AAAGAAGACCAGATTATGTGAGG + Intergenic
1101610163 12:106283891-106283913 GAGGAATACCAGGTTCAGGATGG - Intronic
1101849275 12:108389237-108389259 GAAGAAGAGCAGATGATGGAAGG + Intergenic
1104134378 12:125923445-125923467 GAGGGAGAAGAGATGATGGATGG + Intergenic
1104205843 12:126637572-126637594 GAGGAAGACCAGAAAACGGAGGG + Intergenic
1104222585 12:126799357-126799379 CAGTAAGACTGGATTATGGATGG - Intergenic
1104571440 12:129929615-129929637 GAGGCAGAGCAGAGCATGGAGGG - Intergenic
1105737830 13:23289754-23289776 GAGTGGGACCAGATTATGCAGGG + Intronic
1106667493 13:31867524-31867546 GGGGAAGATATGATTATGGAAGG + Intergenic
1106860722 13:33904682-33904704 GATTAAGGCCAGATTGTGGAAGG - Intronic
1107646107 13:42495915-42495937 GAGGGTGACCAGACCATGGAAGG - Intergenic
1113320119 13:109224922-109224944 GAGGAAGAGAATATTAAGGATGG - Intergenic
1113357190 13:109592026-109592048 GAGGAAGCCCACATTCTGGTTGG + Intergenic
1113532885 13:111042323-111042345 GAGGAAAAACAGATTTGGGAAGG - Intergenic
1113583688 13:111448384-111448406 GATGAGGCCCACATTATGGAAGG - Intergenic
1114205504 14:20567864-20567886 GAGGAAGAGAATATTAAGGATGG + Intergenic
1114590455 14:23860004-23860026 GAGGGAGCCCAGAAAATGGAGGG - Intergenic
1114644550 14:24247540-24247562 GAGGAAGACCATATTATAAAAGG - Intergenic
1114994368 14:28329781-28329803 GAGGAATCCAAGATGATGGAAGG - Intergenic
1115166426 14:30453106-30453128 GAGGAAGATGAGATTATAAAAGG + Intergenic
1116533987 14:46007749-46007771 GAGGAAGATGAGATTTGGGAGGG + Intergenic
1116763030 14:49038378-49038400 GAGGAAGACCGGAATCTGGAAGG - Intergenic
1117162318 14:53001605-53001627 GAGGGAGAGCAGATTATGAAGGG + Intergenic
1117717636 14:58597363-58597385 GATGAGGCCCACATTATGGAGGG + Intergenic
1117978920 14:61322575-61322597 GACGAAGACCAAAGTCTGGAGGG - Intronic
1126105528 15:45144625-45144647 CAGGAAGGCCAGAGGATGGAGGG - Intronic
1126181579 15:45790727-45790749 AAGGAAGACCAGATTGTGCAGGG - Intergenic
1126635970 15:50780163-50780185 GTGGAAGACCAGATTATGAAAGG + Intergenic
1128606121 15:69037841-69037863 GAGGAAGGCCTGATTATGAAGGG + Intronic
1128775992 15:70321027-70321049 GAGGAAGAACAGACAACGGAAGG + Intergenic
1131778421 15:95827508-95827530 AAGGAAAATCAGATTATGAAAGG + Intergenic
1132119284 15:99162781-99162803 GAAGAAAACGAGATTATGGCCGG + Intronic
1132251142 15:100336278-100336300 GAGGAAAACAAGAGTATGCAGGG + Intronic
1134234456 16:12454610-12454632 GAGGAAGAACAGATCAGGCAGGG + Intronic
1137259471 16:46812514-46812536 GAGGTAGACAGGATTGTGGATGG + Intronic
1138672998 16:58630243-58630265 GAGGAACAATAAATTATGGAAGG + Intergenic
1138789649 16:59888179-59888201 GAGGAAAACCAGATTTTGTATGG + Intergenic
1139169844 16:64616546-64616568 GGGGTAAACCAGTTTATGGATGG + Intergenic
1141559952 16:84861237-84861259 GAGGAACACAATATTAAGGATGG - Intronic
1142119836 16:88381850-88381872 GAGGCAGACCAGATTGGGGGAGG + Intergenic
1142981060 17:3671947-3671969 GACCCAGACCAGATCATGGAGGG + Exonic
1143428913 17:6864757-6864779 GAGAAAGACTTGATTTTGGAGGG - Intergenic
1144283011 17:13745468-13745490 GAGGAAGAGCAGGAGATGGAGGG - Intergenic
1144619351 17:16807066-16807088 GACGAAGGACAGATTAAGGAAGG - Intergenic
1144637286 17:16918331-16918353 GAGGAGGTCAAGATTATGGGGGG + Intergenic
1144893342 17:18508639-18508661 GACGAAGGACAGATTAAGGAAGG + Intergenic
1145138884 17:20435653-20435675 GACGAAGGACAGATTAAGGAAGG - Intergenic
1146643898 17:34563634-34563656 GAGGAAGACCAGGTTGGGGAGGG - Intergenic
1146918584 17:36694612-36694634 GAGCAAAAGCAGACTATGGAAGG - Intergenic
1147142573 17:38467616-38467638 AAGGAAGAACAGATGATGGATGG - Intronic
1148808196 17:50274652-50274674 GAGGAAATCCTGATTCTGGAAGG - Intronic
1151089909 17:71426396-71426418 CAGCAAGTCCAGATTATTGATGG + Intergenic
1151469474 17:74309224-74309246 GAGGTAGACCACATCATGGTTGG - Intronic
1152861737 17:82700436-82700458 GAGGAAGAAAAGAGGATGGAAGG + Intergenic
1153597495 18:6742521-6742543 GTGGATGAGCAGATTGTGGATGG + Intronic
1156021839 18:32608319-32608341 GAGAAAGAAAAGATGATGGAAGG - Intergenic
1156539555 18:37896045-37896067 GAGAAAGACCAAGTCATGGAGGG + Intergenic
1156650579 18:39221874-39221896 GAGGAAGCCTAGATTATAGTTGG + Intergenic
1157442569 18:47721942-47721964 GAGGGAGAGCCGATAATGGATGG - Intergenic
1157711355 18:49851937-49851959 GAGGAGGACCACGTTCTGGAAGG + Intronic
1159238032 18:65702929-65702951 GAGTAAGAACAGCTTTTGGATGG - Intergenic
1159681027 18:71352379-71352401 CAGAAAGAGCAGTTTATGGAGGG - Intergenic
1159717263 18:71840969-71840991 GGCAAAGACCAGATCATGGAAGG - Intergenic
1160898096 19:1412239-1412261 GAGGGAGTCCAGGCTATGGAGGG + Intronic
1161094631 19:2383007-2383029 GAGGCCCACCACATTATGGAGGG + Intergenic
1162127829 19:8508838-8508860 GAGAAAGACCAGGCCATGGAGGG + Intergenic
1162809818 19:13156994-13157016 GAAGAAGAACATATTCTGGAGGG + Intergenic
1163540833 19:17909266-17909288 GAGGAAGAGGAGATTCTGGGAGG - Intergenic
1165261590 19:34623682-34623704 GAGTAAGACCATTTAATGGAAGG + Intronic
1165753264 19:38274839-38274861 GAGGTAGACCAGCTTACGGGAGG + Intronic
927269673 2:21192175-21192197 GAGGAAGAGCTGATTTTAGAAGG + Intergenic
928055580 2:28050827-28050849 GAGGAGGAACAGATCAGGGATGG + Intronic
928142764 2:28744940-28744962 GAGGAGGAGCAGAATATGGGTGG - Intergenic
929057564 2:37891433-37891455 AATGAAGACCAGATAATGTAGGG - Intergenic
932379771 2:71271376-71271398 GAGAAAGGCCAGATCATGGCTGG + Intergenic
932642055 2:73458776-73458798 GGAGAAGACTAGATTGTGGAAGG + Intronic
937212416 2:120283482-120283504 CATGAAGATTAGATTATGGAAGG + Intronic
937541327 2:122957850-122957872 GAGGAAGACAAGTTGATGCAGGG + Intergenic
937726353 2:125172031-125172053 GAAGAAGACCATATTGTTGAAGG - Intergenic
938599788 2:132825391-132825413 GAGGAAGACAAAAATCTGGAGGG + Intronic
941383747 2:164827556-164827578 GAATAAGACCAAATAATGGAAGG - Intronic
942985978 2:182142807-182142829 GAAGAAGGCCAAATTGTGGAGGG + Exonic
943147817 2:184067290-184067312 GAGGAAGTGCAGATGATGGCCGG + Intergenic
943168026 2:184357312-184357334 AAGGTAAACCAGATTATGTAGGG + Intergenic
943207277 2:184916996-184917018 GAGGCTCACCATATTATGGAGGG + Intronic
944883951 2:204043782-204043804 GTGGAAGAACTGATTATGGTAGG + Intergenic
945071410 2:205992587-205992609 GAGTAAGACCAGAAGACGGAAGG + Intergenic
946888289 2:224246634-224246656 GAAGAAAACCAGATTTAGGAAGG - Intergenic
948099503 2:235362335-235362357 GAGGAAGACAAGAGTGTGGAAGG - Intergenic
1169572386 20:6920616-6920638 GAGGAAGATAAGATTATAAATGG - Intergenic
1170466251 20:16625086-16625108 TTGGAAAAACAGATTATGGAAGG - Intergenic
1170865236 20:20149757-20149779 AAGGCAGTCCAGATTTTGGAAGG + Intronic
1171327862 20:24311521-24311543 GAGGAGGAGCAGGTTATGGAGGG + Intergenic
1172512889 20:35512907-35512929 GAGGAATTCCAGATTATGGTGGG - Exonic
1172807018 20:37619267-37619289 GAGGATCACAAGATTATGGAGGG - Intergenic
1173160056 20:40645873-40645895 GAGGAAGAGGAGAAGATGGAAGG + Intergenic
1173587449 20:44193624-44193646 GAGTAGGGCCAGATCATGGAGGG - Intergenic
1177628876 21:23701088-23701110 GAGGAAGATGAGATTTGGGAGGG + Intergenic
1185207847 22:49550323-49550345 GAGGAAGACCAGACCATCCAAGG - Intronic
949340953 3:3030342-3030364 TAGGAAGACCAGATTCTCCAAGG - Intronic
950130762 3:10544871-10544893 GAGGAAAAACAAATTCTGGAAGG - Intronic
950165997 3:10799423-10799445 GACGACTACCAGAATATGGATGG - Intergenic
951344923 3:21536463-21536485 GAGGAAGCCCAGTTTGGGGAGGG + Intronic
952519489 3:34142282-34142304 GAAGAAGACCTTATAATGGAAGG + Intergenic
953086336 3:39671676-39671698 GAGGGAGAACAGATAAGGGAGGG - Intergenic
953549224 3:43887845-43887867 GAGGAAGGACAGCTTCTGGAAGG - Intergenic
954681788 3:52349919-52349941 GAGGAAGAGCAGGTGAGGGAAGG + Intronic
955131092 3:56169563-56169585 AAGGAAGACAAGATAAGGGATGG + Intronic
955154799 3:56406371-56406393 GAGTCAGACCAGAGTAGGGAGGG + Intronic
956184213 3:66547063-66547085 GAGGAAGCCCAGATCACGTAAGG - Intergenic
956502945 3:69907119-69907141 TAGGAACACAAGATTATGGAGGG - Intronic
957878380 3:86178764-86178786 AAGGAAGACCATATTGAGGAGGG - Intergenic
958161243 3:89818782-89818804 GAGGGAGACAAGTTTCTGGAAGG - Intergenic
959196163 3:103185759-103185781 GACAAAGACAAGATGATGGAGGG - Intergenic
959377794 3:105606422-105606444 GAGGAACACAATATTAAGGATGG - Intergenic
960023409 3:112981474-112981496 GAGGAAGACAAAATTTTGCAGGG - Intergenic
961867935 3:129967648-129967670 GGAGAAGACCTGAATATGGAGGG + Intergenic
963097292 3:141557532-141557554 GAGTAAGACCAGCTGATGAAAGG + Intronic
963293921 3:143524056-143524078 AAGGAAGACCAGAATGTAGAAGG + Intronic
964614554 3:158648743-158648765 GGGGAAGAACAGATAATGGAGGG - Intronic
964864560 3:161241926-161241948 AAGGAAGACCACATTTTGGTAGG + Intronic
965766925 3:172140634-172140656 CAGAAAGTCCAGGTTATGGAAGG + Intronic
969884514 4:10203434-10203456 GAGGAAGACTGGATTATGCTTGG + Intergenic
974832982 4:67211824-67211846 GAGAAAGACAAGATTTGGGAGGG + Intergenic
975527201 4:75363654-75363676 GGTGAAGACCAGATTCTGGCAGG + Intergenic
977965473 4:103142494-103142516 GAGCAAGACCAACTTAGGGAAGG - Intronic
978114022 4:104997535-104997557 GAGGAAGACCAGATGGTTGTAGG + Intergenic
978260285 4:106748384-106748406 GAAGAAGGCCAGAGTAAGGAGGG + Intergenic
978725149 4:111960794-111960816 GAGGCCCACCACATTATGGAGGG + Intergenic
979906451 4:126299922-126299944 GAGGAAGACCAGATTTGGGAGGG - Intergenic
981505162 4:145491701-145491723 GACGAAAACCATGTTATGGAGGG - Intronic
983177915 4:164613157-164613179 GAGGTTCACCACATTATGGAGGG + Intergenic
984163730 4:176284194-176284216 GAGGAAGGCAAGGTTATGAATGG + Intergenic
985132249 4:186750455-186750477 CAGGAAAACCAGATAGTGGATGG + Intergenic
988320361 5:29686734-29686756 CCAGAAGACAAGATTATGGAAGG - Intergenic
989458055 5:41665013-41665035 GAGGAAGAGAATATTAAGGATGG - Intergenic
989584084 5:43060977-43060999 GATGAAGAACAAAATATGGAAGG - Intergenic
990446666 5:55899543-55899565 GAGCCAGACCAGACTTTGGATGG + Intronic
990785336 5:59412465-59412487 GGGGAAGAACTGATTATAGAGGG + Intronic
990794622 5:59525600-59525622 GAGAAAGATGAGATTTTGGAGGG + Intronic
993512409 5:88787918-88787940 GAGAAAGACGAGAAAATGGAGGG - Intronic
994957438 5:106551455-106551477 GTGGAAGACCAGATGGTGGTAGG - Intergenic
997399614 5:133592103-133592125 GAGGAAGACCAGGATCTGGGTGG - Intronic
998107468 5:139477529-139477551 GAGGAAGACCAGACTAAGCCAGG + Intronic
1000165264 5:158642326-158642348 GAGGAAGACCCTATTATCAAGGG + Intergenic
1001001149 5:168008322-168008344 GAGCAAGACCAGATGATAGATGG + Intronic
1002269263 5:178059069-178059091 AAGGAAGACCAGGTCTTGGAGGG - Intergenic
1003609942 6:7603465-7603487 AAAGGAGGCCAGATTATGGAAGG - Intronic
1007723373 6:43899453-43899475 GAGGAAGAACATGTTTTGGAGGG - Intergenic
1008482740 6:52003527-52003549 GAGAAAAACCAGATTTTGGGGGG - Intronic
1009241724 6:61193505-61193527 GAGGAAGACAAGTTCCTGGATGG - Intergenic
1009284860 6:61803985-61804007 GAGGAAGATGAGATTTGGGAGGG - Intronic
1010168842 6:72950788-72950810 GAGGATGGCCATATCATGGAAGG + Intronic
1011480670 6:87790583-87790605 GAGGAAGAGCTGAATGTGGAGGG + Intergenic
1011571560 6:88742487-88742509 AAAGAAGAACAGATTATTGATGG - Intronic
1012346730 6:98196524-98196546 GAGGAATACCAAATTATAAATGG - Intergenic
1013358837 6:109374332-109374354 GAGGAAGAGCAGTCTATTGATGG - Intronic
1013705333 6:112826360-112826382 AAGGAAGGGGAGATTATGGAGGG + Intergenic
1016294373 6:142559185-142559207 GAGTAAGACCAGACTCTGAAGGG + Intergenic
1018348067 6:162923255-162923277 GACGAACACCAGAATATGCAAGG - Intronic
1018601675 6:165550571-165550593 GAAGAACACAAGATTATTGATGG + Intronic
1020698092 7:11441402-11441424 GAGGTAGCCCAGCTTATGCAAGG - Intronic
1022605280 7:31807236-31807258 GTGGAAGAACAGGCTATGGAGGG + Intronic
1023528120 7:41126486-41126508 GAGAAAAACCAGCATATGGATGG + Intergenic
1024211346 7:47208356-47208378 GAGGTCCACCACATTATGGAAGG + Intergenic
1026479413 7:70765116-70765138 GAGGAAGATCACAGTAAGGAAGG - Intronic
1032208336 7:129889108-129889130 GGCCAAGACCAGATTACGGAGGG + Intronic
1032293471 7:130612484-130612506 GAGGAAGAACAGGATAGGGATGG + Intronic
1035278942 7:157765413-157765435 GAGGAAGAATGGATGATGGATGG - Intronic
1035278991 7:157765616-157765638 GAGGAAGAATGGATGATGGATGG - Intronic
1035279035 7:157765811-157765833 GAGGAAGAATGGATGATGGATGG - Intronic
1035279056 7:157765908-157765930 GAGGAAGAATGGATGATGGATGG - Intronic
1036085903 8:5612557-5612579 GAGGAAGATCAGATTCAGGCAGG + Intergenic
1037835838 8:22214282-22214304 GAGGAAGACAAGATGGTGGCTGG + Intergenic
1038419125 8:27420832-27420854 GACAAAGCCCAGATTATGGAGGG + Intronic
1040445964 8:47493953-47493975 GGGGGAGAGCAAATTATGGAAGG + Intronic
1042917736 8:73891967-73891989 AAGTAAGACCAGGTCATGGAAGG + Intergenic
1044121145 8:88397715-88397737 TAGAAATACCAAATTATGGATGG + Intergenic
1044290553 8:90463792-90463814 CAGGAAGAAAAGATTATGGAAGG + Intergenic
1044392351 8:91666264-91666286 CAAGGAGACCAGATTATGAAGGG - Intergenic
1045544794 8:103118864-103118886 GAGGAAGACCTGGTGATGTATGG - Intergenic
1046552834 8:115738514-115738536 GAACAAGAACAGATTATGAAGGG - Intronic
1047306925 8:123659893-123659915 GAGGATGAATAGATGATGGATGG - Intergenic
1047404836 8:124576809-124576831 GATGAAAACCATATTATGCAAGG + Intronic
1048145663 8:131840283-131840305 GAAAACAACCAGATTATGGAAGG - Intergenic
1048350575 8:133612681-133612703 GATGAAGCCCACATTAGGGAGGG - Intergenic
1048415017 8:134218012-134218034 CAGGAAGAACAGATTATAGCTGG + Intergenic
1048803579 8:138217900-138217922 GATGAAGACAAGATACTGGAGGG + Intronic
1048966496 8:139618651-139618673 GAGGACGACCAGGTTGAGGAAGG + Exonic
1049857043 8:144868860-144868882 GAGGAAGAGGATATTAAGGATGG + Intergenic
1050389322 9:5121876-5121898 GAGGAAGAGCATATTTTGCAAGG + Intronic
1053333894 9:37245945-37245967 AAGTGAGACCAGATTATGAAGGG + Intronic
1055822889 9:80289020-80289042 GAGGAAGATTTGAATATGGAGGG - Intergenic
1056079929 9:83081572-83081594 GAGGAAGACCACATAAGGAAAGG + Intergenic
1057381903 9:94576239-94576261 GAGGAAAACTTGATTAAGGAGGG - Intronic
1058345265 9:103953377-103953399 GGGGAGGACCAGATTAGGGAAGG + Intergenic
1058750491 9:108034293-108034315 GAGCAAGACCATATTGTGGGTGG - Intergenic
1058815863 9:108682201-108682223 GAGGGAGACCAGAGAATGTAAGG + Intergenic
1059035680 9:110751392-110751414 GAGAAAGACCAGAATGAGGATGG + Intronic
1059859866 9:118447673-118447695 AAGTAAGACCAGAATTTGGATGG + Intergenic
1059871963 9:118587573-118587595 GAGAAAGATGAGATTTTGGAGGG + Intergenic
1185603513 X:1354696-1354718 GAGGAAGAGAAGAAAATGGAGGG + Intronic
1185893865 X:3842276-3842298 GAGGAAACCCTGATTTTGGAAGG - Intronic
1185898980 X:3880700-3880722 GAGGAAACCCTGATTTTGGAAGG - Intergenic
1185904097 X:3919129-3919151 GAGGAAACCCTGATTTTGGAAGG - Intergenic
1186161775 X:6784425-6784447 GAGTAAGACCTAATTCTGGAGGG - Intergenic
1187383621 X:18827872-18827894 GAGGAATACCAGGTTATTCATGG + Exonic
1187445499 X:19357195-19357217 GAGGATCACCTGATTCTGGAAGG - Intronic
1187668095 X:21638211-21638233 GAGGAGGATTAGATTATAGAGGG - Intronic
1187820399 X:23281725-23281747 GTGGAAGACCAAATTCTGGCAGG + Intergenic
1190913555 X:54793414-54793436 GAGGAGGAGCAGATTTGGGAGGG - Intronic
1191911760 X:66159229-66159251 TTTGAAGACCAGATTATGGGGGG + Intergenic
1192699921 X:73458007-73458029 GAGGGAGACCAGGTTATGTAAGG + Intergenic
1192780943 X:74293313-74293335 GGGGAAGAACAGAACATGGAGGG - Intergenic
1193143049 X:78049147-78049169 GAGAAAGAGGTGATTATGGAGGG + Exonic
1193468348 X:81872634-81872656 GAGGAAGTCCAGAAAAGGGAGGG - Intergenic
1194345277 X:92756194-92756216 GAGAAAGATGAGATTTTGGAGGG + Intergenic
1194797140 X:98225681-98225703 GAAGAGTACAAGATTATGGAAGG - Intergenic
1196999494 X:121422950-121422972 GAGGAAGGCAAGATTAGTGAGGG - Intergenic
1198258306 X:134944499-134944521 GAAGGGGACCAAATTATGGAGGG + Intergenic
1198373626 X:136015911-136015933 GAGGGACACGAGATTATGAAGGG + Intronic
1198396934 X:136229076-136229098 GAGGAAGACAAGCTTATGCTCGG + Intronic
1200340706 X:155392340-155392362 GAGGAAGAGAATATTAAGGATGG - Intergenic
1201286715 Y:12385331-12385353 GAGGCCCACCACATTATGGAGGG + Intergenic