ID: 1077900833

View in Genome Browser
Species Human (GRCh38)
Location 11:6487104-6487126
Sequence CAGTGTGGCCAGAGCACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 1, 2: 14, 3: 71, 4: 489}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077900833_1077900838 25 Left 1077900833 11:6487104-6487126 CCCTCTGTGCTCTGGCCACACTG 0: 1
1: 1
2: 14
3: 71
4: 489
Right 1077900838 11:6487152-6487174 TCATGTACTGTTTCATCTCAAGG 0: 1
1: 0
2: 0
3: 25
4: 531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077900833 Original CRISPR CAGTGTGGCCAGAGCACAGA GGG (reversed) Intronic
900819984 1:4879252-4879274 CACTGTGGCCAGGCCACGGAGGG + Intergenic
901245833 1:7730319-7730341 CCGTGTGGCTGGAGCACAGAGGG - Intronic
901864357 1:12094419-12094441 CAGTGTGGCTAGAGATCAGAGGG + Intronic
901989410 1:13100656-13100678 CAGTGTGGCCAGACCTGGGAAGG + Intergenic
901992403 1:13126108-13126130 CAGTGTGGCCAGACCTGGGAAGG - Intergenic
902070088 1:13727078-13727100 CCATGTGTCCAGAGCAGAGAAGG - Intronic
902200462 1:14829763-14829785 TAGTGTGGCCAGAGCATAGAAGG + Intronic
902662531 1:17915083-17915105 CAGAGTAGCTAGAGCACTGAAGG + Intergenic
902796358 1:18803220-18803242 CAGGGCGCCCAGGGCACAGAAGG + Intergenic
904076443 1:27846307-27846329 CAGTGTTTCTGGAGCACAGAGGG - Intronic
905019076 1:34796037-34796059 CAGTGTGGCCAGGGCGACGATGG - Intronic
905042921 1:34975289-34975311 CAGAGTTGTCAAAGCACAGAAGG + Intergenic
905312007 1:37055847-37055869 CAGGGTGCTCAGAGCACAGTAGG - Intergenic
905408817 1:37754300-37754322 CACCGTGCCCAGAGCACAGCCGG - Exonic
905867671 1:41385057-41385079 TAGTGGGGTCAGAGCCCAGAAGG + Intergenic
906527436 1:46503089-46503111 CAGGGTGGCTGGAGCACAGATGG - Intergenic
906612468 1:47212915-47212937 GAGAGAGGCCAGGGCACAGAAGG - Intergenic
907274063 1:53307297-53307319 AAGTGTGGCAAGTGCACAGCTGG - Intronic
907330054 1:53664891-53664913 CCCTGGGGCAAGAGCACAGATGG + Intronic
907337854 1:53712117-53712139 TGGTGTTGCCAGAGCAGAGATGG - Intronic
907403379 1:54239406-54239428 CAGTGTGGACACGGCACAGGGGG + Intronic
907470767 1:54672055-54672077 CAGTGTGACTGGAGCCCAGAGGG + Intronic
908417057 1:63923422-63923444 CAGTGGTGCCAGATCACAGTAGG + Intronic
908569910 1:65398658-65398680 GAGTGTGGCAAGAACTCAGAAGG + Intronic
911807007 1:102222964-102222986 CAGTGTGGCTAGAGTAAAGCAGG + Intergenic
912468059 1:109887502-109887524 CAGAGTGGCCAGAGACAAGAGGG - Intergenic
912934395 1:113990272-113990294 TAGTGTGGAAAGAGCACAGGTGG + Intergenic
913021540 1:114792644-114792666 CAGTGGGGACAGCCCACAGAGGG - Intergenic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915113303 1:153578575-153578597 CAGTGTGGCTGGAGCATGGATGG + Intergenic
915323722 1:155070052-155070074 CAGTGTGGGCTGAGAGCAGAGGG - Intergenic
915382854 1:155458756-155458778 CAGTGTGGTCAGACTAAAGACGG - Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
915786206 1:158615184-158615206 GCGTGTGGCCAGAGCAGGGAGGG - Intronic
916256086 1:162789588-162789610 CAGTTTGGTCTGAGAACAGAAGG + Intergenic
916353703 1:163880857-163880879 TAGTCTGGCCAGATCAGAGAGGG + Intergenic
916486758 1:165266393-165266415 CAGTGTGGCTGGGGCAAAGATGG + Intronic
917468610 1:175306896-175306918 CAGAGTGGCTGAAGCACAGATGG - Intergenic
918123820 1:181564835-181564857 CAGTGTACCAAGAGCACTGATGG - Intronic
918882757 1:190146680-190146702 CAGTGTAGCCAGAGCACTTCTGG + Intronic
920099685 1:203509026-203509048 CTGTGGTGCCTGAGCACAGAAGG - Intergenic
920185229 1:204155283-204155305 CAGTGTGGCTAGGGGAGAGATGG - Intronic
920805024 1:209224872-209224894 CAGTGTGGTTGGAGCACAGAGGG - Intergenic
920834189 1:209492868-209492890 CAGTGTAGCTAGAGCTCAGTGGG + Intergenic
921100485 1:211924495-211924517 CAGTTTGGACAGGGCACAGAGGG + Intergenic
921670185 1:217916427-217916449 GAGAGTGCCCAGAACACAGAAGG + Intergenic
921670371 1:217918061-217918083 CAGTGTGGACAGATGACACAAGG - Intergenic
921961125 1:221035369-221035391 AAGTGTGAGCAGAGCACTGAGGG - Intergenic
922227632 1:223659371-223659393 CAGTGGGGCCAGATCACAGAGGG - Intronic
922777028 1:228219553-228219575 CTGTGAGGCCAGGGGACAGAGGG + Exonic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923333352 1:232946177-232946199 CAGTGTGGCCGGAGCAGAGTAGG - Intergenic
924218345 1:241848253-241848275 CACTGTGGCCAGAGCACCCACGG - Exonic
924583485 1:245341815-245341837 CAGTTGGGGCAGAGCTCAGAGGG + Intronic
1063159173 10:3407373-3407395 CAGTGTGCTCAGAACAGAGATGG - Intergenic
1063207810 10:3851096-3851118 GAGTATTGCCAGAGCCCAGAAGG + Intergenic
1063702226 10:8395449-8395471 CCATGTGGCCAGAGCTCAGGTGG + Intergenic
1064367057 10:14717638-14717660 CAGTGTGGCTAGAACAAAGCAGG - Intronic
1065052283 10:21807351-21807373 CAGTGTGGTTAGAGCACAGTGGG - Intronic
1065140895 10:22717065-22717087 CAGTCTGCCAAGGGCACAGAAGG - Intergenic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1065226845 10:23552272-23552294 CAGTGTGGCCAGAATAAAGCAGG + Intergenic
1066371828 10:34824154-34824176 TAGTGTGTCCAAAGCAAAGAGGG - Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067234277 10:44435276-44435298 CAGTGTCCCCAAAGCATAGATGG + Intergenic
1067687479 10:48475899-48475921 CAGTGTGGCCAGAGCAGAGTGGG - Intronic
1068280704 10:54865212-54865234 CAGTGTGGCTAGAACAAAGCAGG + Intronic
1068461676 10:57337185-57337207 GAGCGTGGCCAGAGCAGAGGTGG + Intergenic
1069150863 10:64957929-64957951 CAGTGTGGACACATCTCAGAGGG + Intergenic
1069377849 10:67812236-67812258 CAGTGTGGCTGGAGGACACAAGG + Intronic
1069507986 10:69018841-69018863 CAGTGTGGCTGGAGCAGATAAGG + Intergenic
1069817273 10:71206401-71206423 CAGTGTGGCCAAAACAAAGCAGG + Intergenic
1072086690 10:92086619-92086641 CAGTGTGCCCAGAGCTCTCATGG - Intronic
1072250599 10:93579283-93579305 CAGCGGGGCCAGACCACACAGGG - Intronic
1072334478 10:94385255-94385277 CAGTGTGGCCTGAACACCCACGG + Intergenic
1072736335 10:97881969-97881991 CAGTGTGATCAGGGCCCAGATGG - Intronic
1072758730 10:98038539-98038561 CAGGGAGGCCAGAGGTCAGAGGG + Intergenic
1074673783 10:115825600-115825622 CAGTGTGGACAGATCTCAAAGGG - Intronic
1075283322 10:121160385-121160407 CAGTTTGGCCAGAGCTCAGCAGG - Intergenic
1075510975 10:123072923-123072945 CAGGGCAGCCTGAGCACAGATGG + Intergenic
1075878561 10:125828758-125828780 CAGTTTGGACAGAGCTCAGTGGG + Intronic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076882487 10:133246264-133246286 CAGTGTTGGGAGAGCCCAGAGGG - Intergenic
1077317949 11:1927623-1927645 CACTGAGGCCAGCGGACAGACGG + Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077705958 11:4485849-4485871 CAGTGGGGCCAAATCACACAGGG - Intergenic
1077900833 11:6487104-6487126 CAGTGTGGCCAGAGCACAGAGGG - Intronic
1078428769 11:11271388-11271410 CTGTGTGGCCAGATCCCAGGAGG + Intronic
1078809515 11:14743874-14743896 CAGTGGGTCCAGCCCACAGAGGG - Intronic
1080149905 11:29039522-29039544 CAGTGTAGCTAAAGCACAGTGGG - Intergenic
1080686874 11:34523316-34523338 CAATGTGGCCAGAGTTCAAAGGG - Intergenic
1080751980 11:35159037-35159059 CTCTGAGGCCAGAGAACAGAAGG + Intronic
1081390874 11:42527181-42527203 CAGTATGGACAGAGCAGAGAAGG + Intergenic
1081427251 11:42938846-42938868 CAATGTGGCTAGAGCAGAGTTGG - Intergenic
1084464217 11:69312944-69312966 CACAGTGACCAGGGCACAGAAGG - Intronic
1084706638 11:70819745-70819767 CAGCATGGCAGGAGCACAGAGGG - Intronic
1085532639 11:77201052-77201074 CCGTGTGACCAGAGCACAGGGGG + Intronic
1085762622 11:79255269-79255291 CATGGTGCCCAGTGCACAGAAGG + Intronic
1086875153 11:92086925-92086947 AAGAGGTGCCAGAGCACAGATGG + Intergenic
1087286587 11:96270923-96270945 CAGTGTGGCTAGAGTAAAGCAGG + Intronic
1087596763 11:100263841-100263863 TAGTGTGGCAAGAGCAGACAGGG - Intronic
1087648277 11:100833431-100833453 CAGTTTGGGCAGGGCTCAGATGG + Intronic
1087696913 11:101389781-101389803 CAGTATGACCAAAGCACAGAAGG - Intergenic
1089665637 11:120016649-120016671 GTGTGAGGCCAAAGCACAGATGG - Intergenic
1089676337 11:120092537-120092559 CAGTGTGGCTGGTGCAGAGAGGG + Intergenic
1089789400 11:120931895-120931917 CAGAGTGGCTAGAACACACAGGG - Intronic
1090326988 11:125896502-125896524 CTGTCTGGCCAGTTCACAGAGGG + Intronic
1090572491 11:128062643-128062665 CAGGGTGGCAGGAGCAAAGATGG + Intergenic
1090751777 11:129752562-129752584 CAGAGTGTGCAGAGCACAGCTGG + Intergenic
1091330013 11:134724938-134724960 AAGTGTGGCCCGAGCGGAGACGG + Intergenic
1092105512 12:5919281-5919303 AAGAGTGCCCAAAGCACAGAGGG + Intronic
1093270656 12:17056750-17056772 CAGTGCTGCTATAGCACAGATGG - Intergenic
1094414803 12:30205151-30205173 GTGTGTGGCCAGAGACCAGAGGG - Intergenic
1094414814 12:30205269-30205291 GTGTGTGGCCAGAGACCAGAGGG - Intergenic
1094472071 12:30812147-30812169 CAGTGTGGCTAGAACAAAGCAGG - Intergenic
1095281812 12:40360760-40360782 CAGTTTGGGTAAAGCACAGATGG - Intronic
1096848996 12:54423493-54423515 CAGTTTGCACAGAGCACAGGAGG + Intergenic
1098039678 12:66341330-66341352 CAGTGAGGCTAGAACACAGCAGG - Exonic
1098979709 12:76943046-76943068 CAGAGTGTCCAGAGCACTGAGGG - Intergenic
1099220840 12:79912023-79912045 CAGTGTGACTGGAGCACAGGGGG - Intronic
1099888564 12:88561743-88561765 CAGTGTGGCTAGAGCATGGTGGG - Intronic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1100914108 12:99398849-99398871 CATTATGTCCAGAGAACAGACGG - Intronic
1101094857 12:101327656-101327678 CAGAGTGTCCAGGGCACAGGAGG - Intronic
1101714158 12:107295855-107295877 AGGTGAGGCCAGAGCACAGGAGG + Intergenic
1104261052 12:127182385-127182407 CAGTGTGGCTAGAATACAGCAGG - Intergenic
1104327245 12:127811117-127811139 CAGAGTGGGCAGACCACAGCAGG + Intergenic
1104850786 12:131872566-131872588 CAGTGTGGCCTGAAGACAGTGGG - Intergenic
1104882752 12:132084036-132084058 CAGTGTGACCAGCGCTCAGCAGG + Intergenic
1105299060 13:19117091-19117113 CAGTGGGGACAGGGCACTGAGGG - Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1106621588 13:31375950-31375972 CAGTGTGTACAAAGCACACAAGG - Intergenic
1107829632 13:44362877-44362899 CAGAGTGCCCAGAGAACAGGAGG + Intergenic
1108225561 13:48285517-48285539 CCATGTGGCCTGAGCACAGCAGG - Intergenic
1108782835 13:53857650-53857672 CAGTGTGGCTAGAGCAGATTGGG + Intergenic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1110968693 13:81733387-81733409 CAGTGTGTACAGCCCACAGAGGG - Intergenic
1112378537 13:98866099-98866121 CAGGGTGGCCAGATAACAGTTGG - Intronic
1113971590 13:114195389-114195411 CAATGTGGTGACAGCACAGAGGG - Intergenic
1114335938 14:21690091-21690113 CAGTGGGGGCAGCCCACAGAGGG + Intergenic
1115536655 14:34379539-34379561 CACTGTGGCCAGAGCTCAGGAGG + Intronic
1115983841 14:39083481-39083503 CAAGGTGGTCAGAGCACAGTTGG - Intronic
1116745277 14:48810166-48810188 CAGTGAGGCTAAAGCACAAAAGG + Intergenic
1117090757 14:52247736-52247758 CAGTGTGGCCAGAGAAGTCAGGG + Intergenic
1117753907 14:58954255-58954277 CAGTGTGGCTGGTGCACAGGTGG - Intergenic
1118359083 14:65040852-65040874 CAGCGCGGCCAGGCCACAGAAGG - Exonic
1119004676 14:70912797-70912819 CAGTGTGACTACAGCACAGTGGG - Intronic
1120171379 14:81249731-81249753 CAATTTGGACAGGGCACAGAGGG + Intergenic
1120701400 14:87703261-87703283 CACTGTGGACAGAGGACTGAAGG - Intergenic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121093940 14:91202751-91202773 CAGGGTCGTCACAGCACAGATGG - Intronic
1121104515 14:91271807-91271829 CAGTGTGCACAGTGCACCGAGGG - Exonic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1121902134 14:97703326-97703348 CACTGTGGTCAGAGCCCAGGTGG - Intergenic
1122048803 14:99041433-99041455 CAGTCTGGCCAGAGTGCAGAGGG - Intergenic
1122154117 14:99740140-99740162 CAGTGTGTCCAGGACACAGTGGG - Intronic
1122588067 14:102825111-102825133 CAGCGTGGGCAGAGCAGAAAGGG - Intronic
1122595089 14:102885023-102885045 CACTGTGGCCAGGGAAGAGAAGG - Intronic
1122724126 14:103739454-103739476 CAGTGTTGACGGAGCAGAGAGGG - Intronic
1122881575 14:104692739-104692761 CAGTGTGGTCACAGCCCAGATGG + Intronic
1123662218 15:22574412-22574434 CGGTGTAGCCAGAGGACAGAGGG + Intergenic
1124262000 15:28201095-28201117 CGGTGTAGCCAGAGGACAGAGGG - Intronic
1124264279 15:28219614-28219636 CTGTGTGCCCCGAGCCCAGACGG + Intronic
1124316020 15:28668694-28668716 CGGTGTAGCCAGAGGACAGAGGG + Intergenic
1124582952 15:30978040-30978062 CACTGTGGGCAGAGCAGTGAGGG - Intronic
1125310650 15:38374892-38374914 CAGTGTGGCCAGAGCTCTGAAGG - Intergenic
1125521896 15:40352722-40352744 CAGTGTGCCCAGTGCAGGGACGG - Intronic
1128336177 15:66787094-66787116 CAGTGTGGTCAGAGCCTGGATGG - Intergenic
1128345996 15:66852698-66852720 CACTGTGCCCAGCCCACAGAAGG - Intergenic
1128377348 15:67086755-67086777 CTGTGTGGCCAGGACATAGAAGG - Intronic
1128458069 15:67844118-67844140 CTGTGTGCCCACAGCTCAGAGGG + Intergenic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1129724584 15:77895069-77895091 CAGGGCGGTCAGAGCACAAAGGG - Intergenic
1129832783 15:78681615-78681637 CAGTGAGGCCACAGGAGAGAGGG + Intronic
1130159722 15:81386506-81386528 CAGTGTGGCCAGAGCAGGGTAGG - Intergenic
1130272604 15:82459851-82459873 CAGTGCAGTCAGAGCACAAAGGG - Intergenic
1130464956 15:84187204-84187226 CAGTGTAGTCAGAGCACAAAGGG - Intergenic
1130487732 15:84407600-84407622 CAGTGCAGTCAGAGCACAAAGGG + Intergenic
1130499309 15:84486333-84486355 CAGTGTAGTCAGAGCACAAAGGG + Intergenic
1130587246 15:85191818-85191840 CAGTGCAGTCAGAGCACAAAGGG - Intergenic
1131152720 15:90057050-90057072 GAGTGAGGCCAGAACACAAAGGG - Intronic
1131956327 15:97740127-97740149 CAGTGTGACCAGAGCAGCCATGG + Intergenic
1132464220 16:70342-70364 ACGTCTGGCCAGAGGACAGATGG + Intronic
1132648963 16:1011960-1011982 CGGTGGGGTCAGACCACAGAGGG + Intergenic
1132853733 16:2035750-2035772 TAGTGTGGACAGGGCACAGAGGG - Intronic
1132867993 16:2103324-2103346 CAGGGTGACCACAGCACCGACGG + Exonic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1133820856 16:9235311-9235333 CAAGGTGGTCAGAGCACAGTTGG + Intergenic
1134362744 16:13546940-13546962 CAGTGTGGCTGTAGCACAGCAGG - Intergenic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1134523778 16:14929790-14929812 CAGGGTGACCACAGCACCGACGG - Intronic
1134541668 16:15071960-15071982 CAGTGTGTCCAGAGACCGGAAGG - Intronic
1134549124 16:15131145-15131167 CAGGGTGACCACAGCACCGACGG + Intronic
1134711369 16:16328275-16328297 CAGGGTGACCACAGCACCGACGG - Intergenic
1134719219 16:16371578-16371600 CAGGGTGACCACAGCACCGACGG - Intergenic
1134948207 16:18340307-18340329 CAGGGTGACCACAGCACCGACGG + Intergenic
1134955460 16:18380418-18380440 CAGGGTGACCACAGCACCGACGG + Intergenic
1135359652 16:21801552-21801574 CAGTGTGTCCAGAGACCGGAAGG - Intergenic
1135437118 16:22436527-22436549 CAGTGTGTCCAGAGACCGGAAGG - Intronic
1135641707 16:24125364-24125386 TGTTGTGGCCAGAGCACAGTGGG - Intronic
1135701567 16:24637349-24637371 CAGGCTGCCCAGACCACAGATGG - Intergenic
1136263144 16:29095400-29095422 CAGTGTGTCCAGAGACCGGAAGG + Intergenic
1136515012 16:30762722-30762744 CAGTTTGGCCAGAGAACAGAGGG - Intronic
1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG + Intergenic
1137589624 16:49685677-49685699 CAGTGGGGACCGAGAACAGAGGG - Intronic
1138206000 16:55125493-55125515 CAGTGTGGCCAGAACAGGGTAGG + Intergenic
1139273918 16:65709282-65709304 CTGTGTGACCACATCACAGAAGG + Intergenic
1139412278 16:66773463-66773485 CAGTGTAGCTTGAGCTCAGAGGG - Intronic
1139607890 16:68032940-68032962 CAGGGTGGCCAGGGCCGAGAGGG + Intronic
1140257035 16:73346324-73346346 CATGGTGGCGAGAGGACAGACGG - Intergenic
1140796052 16:78439322-78439344 CAGTGTGGTCCAACCACAGAGGG - Intronic
1140902364 16:79381050-79381072 CAGGGAGGCCAGAGCAGAGGTGG - Intergenic
1142110556 16:88328869-88328891 CAGTTTGGCCACAGCAGAGGAGG + Intergenic
1142127464 16:88417271-88417293 CAGTGTGCCCACTTCACAGATGG - Intergenic
1142868483 17:2805696-2805718 CTCTGTGGAGAGAGCACAGAGGG - Intronic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1143514227 17:7411395-7411417 CAGTGTGGGCAAAGCAGGGAAGG - Intronic
1143947113 17:10603197-10603219 CAGTGTGGCAGGAACACAGTGGG + Intergenic
1143980442 17:10864830-10864852 CTGAGTGGCAACAGCACAGATGG + Intergenic
1144223404 17:13120683-13120705 GAATGTGGTCAGACCACAGAGGG - Intergenic
1144403545 17:14929889-14929911 CGGAGTGGGCAGAGCACAGATGG + Intergenic
1144520388 17:15948768-15948790 CAATGTGGCAAGAGCAGAGAGGG - Intronic
1144669903 17:17127060-17127082 TAAGGTGGCCAGAGCAAAGAGGG - Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1146515724 17:33487715-33487737 CAGCGTGGCCAGAATAAAGAAGG + Intronic
1147169237 17:38608538-38608560 AAGTGGAGCCAGAGGACAGATGG + Intergenic
1147675257 17:42200909-42200931 CACTCTGGCCAGAACACAAACGG + Exonic
1148093776 17:45038654-45038676 GACAATGGCCAGAGCACAGATGG + Intronic
1148159410 17:45441571-45441593 GACTGTGGTCAGAGGACAGATGG - Intronic
1148324657 17:46776288-46776310 CAGTGAGCCCAGAGCCCTGATGG + Intronic
1148444189 17:47727699-47727721 CAGTGTGAACACAGAACAGAGGG - Intergenic
1150329653 17:64284630-64284652 CAGAATGGCCAGACCACTGAAGG - Intergenic
1150390745 17:64788656-64788678 GACTGTGGTCAGAGGACAGATGG - Intergenic
1152036405 17:77875776-77875798 AAGTGTGGCAGGAACACAGAGGG + Intergenic
1152210496 17:79000670-79000692 CAGTGTGGTCAGGGGACAGAAGG - Intronic
1152828953 17:82485689-82485711 CAGTGTGGCCTGAGCACCCGTGG - Intronic
1155318143 18:24592581-24592603 CAGAGAGGCAAGAGCACACACGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156176179 18:34549203-34549225 TAGTGTGGACAGATCATAGAGGG - Intronic
1157141055 18:45107002-45107024 TTGTGTGTCCAGGGCACAGAAGG - Intergenic
1157609307 18:48946358-48946380 CATTGAGGTCAGACCACAGATGG - Intronic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1158943208 18:62425336-62425358 CAGTGTGGCCCGAACACAGATGG - Intergenic
1159570827 18:70110391-70110413 CAGTGGGTGCAGGGCACAGAGGG + Intronic
1159574143 18:70155650-70155672 CAGTCTGCACAGAGCCCAGAGGG + Intronic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1161486239 19:4537342-4537364 CAGTGTGGCCAGGGCTCAGCTGG + Exonic
1161615264 19:5266705-5266727 GAGGGTGGCCGGACCACAGAAGG - Intronic
1161723289 19:5915207-5915229 CAGTGTGACCTGGGAACAGAGGG - Exonic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1163429919 19:17261216-17261238 CAGTGTGGCTGGAACACAGGGGG - Intronic
1163530110 19:17843857-17843879 CTCCGTGGCCAGAGCAAAGAGGG + Exonic
1164522600 19:28990547-28990569 GAGTCTGGCCATAGTACAGAGGG - Intergenic
1166219612 19:41355995-41356017 CAGTATGGCTGGAGCCCAGACGG + Intronic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1167144719 19:47674906-47674928 CAGTCTGGCCAGCACTCAGAGGG + Intronic
1167176619 19:47868965-47868987 CAGTGGGGTCAGATCAGAGATGG + Intergenic
1167211777 19:48138022-48138044 GAGTGTGGACAGAGCAGAGAAGG + Intronic
1167284189 19:48589521-48589543 GAGCGTGGACAGAGCAGAGAGGG + Intronic
1167288013 19:48609799-48609821 CAGTGTGCTCAGAGAACAGCTGG - Intronic
1167673623 19:50870988-50871010 CTGTGTGGTCAGAGCCCAGAGGG + Intronic
1167882119 19:52468729-52468751 CAGTGTGGCTAGAACAAAGCAGG + Intronic
1168453557 19:56485546-56485568 GAGTGTGGCCAGAGGCCAGATGG + Intergenic
1202698905 1_KI270712v1_random:148046-148068 CAGAGTGTCCAGAGCAATGAGGG + Intergenic
925173485 2:1766992-1767014 CAGAGTGTCCAGAGCTCAGCAGG - Intergenic
925235102 2:2271173-2271195 CAGTCTGGCCAGGTCACAGGGGG + Intronic
925752779 2:7104756-7104778 CAGTGTGGACTGAGGCCAGAAGG + Intergenic
925865266 2:8221428-8221450 CAGTGTGGGCTGTGCACAGAGGG - Intergenic
926709602 2:15867923-15867945 CAGAGTGGACGGAGCACACAAGG + Intergenic
927519934 2:23692595-23692617 CAGTGAGGCTCGCGCACAGATGG + Intronic
927683663 2:25156255-25156277 CTGTGTGCCCACAGCAGAGATGG - Exonic
928103961 2:28455631-28455653 CAGTAGGGCCAGAGCCCAAATGG + Intergenic
928214744 2:29351941-29351963 CACTGTGGCCAGAGCTGAGAAGG - Intronic
928226670 2:29455215-29455237 CAGTGTGAAGAGAGCCCAGAGGG + Intronic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
929349265 2:40928990-40929012 CAGTGTGGTCAGAGCAGAAATGG + Intergenic
930072143 2:47375014-47375036 TATTGTGTCCAGAGAACAGAGGG + Intronic
931121056 2:59220230-59220252 CAGTGTGCACAGAGCACAGCCGG + Intergenic
931514832 2:63044110-63044132 CAGTCTGGCCAGAGAGCAGTTGG + Intronic
931589942 2:63871780-63871802 CAGGATGGCCAGAGAAAAGAGGG - Intronic
932055064 2:68434995-68435017 CAGTATGGCAAAAGCACAGTGGG + Intergenic
932188746 2:69720842-69720864 TGGTATGGCCAGAGTACAGAGGG + Intronic
932579296 2:72983135-72983157 CAGGGTGGACTGAGCACAAAGGG + Intronic
935259016 2:101338624-101338646 CTGTGGGGCCAGAGCCCAAAAGG + Intergenic
936010105 2:108920091-108920113 CGGTGTGGACAGCACACAGAAGG - Intronic
936092867 2:109512202-109512224 CAGTGGGGCCAGGGCCCAGCAGG - Intergenic
936796034 2:116204767-116204789 CAGTCTGTGCAGAGCTCAGAAGG - Intergenic
936909837 2:117579363-117579385 CAGTGGGGGCAGCCCACAGAGGG + Intergenic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
938902709 2:135811563-135811585 CAGTGTGGCTGGAGCAATGAGGG + Intronic
939177569 2:138767252-138767274 CAGTGTGGCCTGACCACAGAAGG + Intronic
939795690 2:146641952-146641974 CAGTGGGTCCAGCCCACAGAGGG + Intergenic
940259565 2:151765944-151765966 GAGTGTGGCCTGAGCACGGAGGG - Intergenic
940427385 2:153545761-153545783 TAGTGTGGCCAGACCAGAGTTGG - Intergenic
940711424 2:157167049-157167071 CAGTGTGGCTAGAACAAAGCAGG + Intergenic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941631017 2:167884280-167884302 CAGTATGGCCAGAGCACAGAGGG - Intergenic
942540444 2:177009775-177009797 CAACATGGCCAGAGCTCAGAGGG - Intergenic
945420834 2:209634048-209634070 CGGTGTGGCTGGAGCAAAGATGG - Intronic
946141923 2:217698691-217698713 CTCTGTGGTCTGAGCACAGATGG - Intronic
947275101 2:228381894-228381916 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
947517460 2:230819075-230819097 CAGTGTGGCAAGTGCACACCTGG + Exonic
947668365 2:231921265-231921287 CAGTGAGCCGAGATCACAGACGG - Intergenic
947915776 2:233830843-233830865 CAGTGTGGGCTGAAGACAGAGGG - Intronic
948428825 2:237905542-237905564 CTGTTTGGCCAGTGCAGAGATGG + Intronic
948486088 2:238282198-238282220 CTCTGTGGTCAGAGCACACAGGG - Intronic
948594881 2:239073518-239073540 CACTGTGCCAAGAGCACAGGCGG + Intronic
1168788079 20:557017-557039 CATTGAGGCTAGAGCACAGTGGG - Intergenic
1168847714 20:956834-956856 CAGTCTGGGCAGAGCCCAGGGGG - Intergenic
1169194578 20:3676275-3676297 CAGGAGGGCCAGATCACAGAAGG - Intronic
1169263012 20:4151225-4151247 CAGTGGAGTCAGAGCACAGAGGG - Intronic
1169745947 20:8942989-8943011 CATTGTGGTCAGAGGAGAGAAGG - Intronic
1170574628 20:17653061-17653083 AAGTGTGCCCGGAGCAGAGAAGG + Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1171426524 20:25051984-25052006 CATGGTGGCCAGAACAAAGATGG - Intronic
1172041045 20:32046156-32046178 CATTGTGGCTGGAACACAGAGGG - Intergenic
1172486584 20:35301988-35302010 CAGTGTGCTCAGAGAAGAGATGG + Intergenic
1172758148 20:37301958-37301980 GACTGTGGCCAGAGCACAGAGGG + Intronic
1172763928 20:37340872-37340894 CTGTGTGGCCGGTTCACAGATGG - Intergenic
1173384093 20:42572421-42572443 CCATGTGGCCACAGCAGAGAAGG - Intronic
1173456909 20:43210088-43210110 CACTGTGGCCAAAGTACAGCAGG + Intergenic
1173916300 20:46710710-46710732 CAGGATGGCCAGAGCACAGCGGG + Intronic
1174126308 20:48309445-48309467 CAGTGTGGCCACAGCAGAGTGGG - Intergenic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1175179370 20:57134663-57134685 GAGTGTGGGCTGAGCACAGGGGG + Intergenic
1175621993 20:60455103-60455125 CAGTGAAACCAGAGGACAGATGG + Intergenic
1176146350 20:63567224-63567246 CAGTGTGGCCAGGGCCCGGGCGG - Exonic
1176148745 20:63577983-63578005 CACTGTGGCCTGAGCACAGCTGG - Intergenic
1176382452 21:6120127-6120149 CAGCCTGCCCAGAGCACTGAGGG - Intronic
1176891691 21:14326984-14327006 CAGTGAGTCCAGCCCACAGAGGG + Intergenic
1177160849 21:17546500-17546522 CCACGTGGCCAGAGCAGAGAAGG + Intronic
1178018361 21:28378621-28378643 CAGAGTGGCCAGATCACATAGGG + Intergenic
1178431500 21:32522196-32522218 GAGTGTGGCCAGGGGACGGAAGG - Intergenic
1178624647 21:34204640-34204662 CAGTGTTGCCAGCGCACAGCAGG + Intergenic
1178660607 21:34504391-34504413 CAGGGTGGCCAGAATACAAAAGG + Intergenic
1178798449 21:35767748-35767770 CAGTGTGGCTACAGGAGAGAAGG - Intronic
1179552664 21:42153432-42153454 CAGAGTGGCCACTGTACAGAAGG + Intergenic
1179741020 21:43418112-43418134 CAGCCTGCCCAGAGCACTGAGGG + Intronic
1179895244 21:44358197-44358219 CAGGGTGGCCACAGCAGACACGG - Intronic
1180703060 22:17792110-17792132 CACTGTGGCAGGAGGACAGAAGG + Intronic
1180720209 22:17902398-17902420 CAGTGGGGACAAACCACAGAAGG + Intronic
1180864757 22:19111188-19111210 CTGTGTGGTGAGATCACAGAGGG + Intronic
1181054889 22:20256231-20256253 CACTGAGCCCAGGGCACAGAGGG + Intronic
1181265160 22:21626798-21626820 GAGTGTGGCCAGATCTCAGCAGG + Intergenic
1181610299 22:24007370-24007392 GAGTGGGGCCTGGGCACAGAGGG - Intergenic
1181804450 22:25366541-25366563 CAGCGTGGCCAGGGCTCAGTGGG - Intronic
1181967350 22:26666508-26666530 CAGTGTGGCAGGAGCAGAGCTGG + Intergenic
1182431692 22:30302589-30302611 CAGTATGGCCACAGCTGAGATGG + Intronic
1182471281 22:30549832-30549854 CTGAGTGGGCAGAGCCCAGATGG + Intergenic
1182953934 22:34403191-34403213 CAGTATGGCTAGAGCATAGCGGG - Intergenic
1183097334 22:35560932-35560954 CAATGTAGCTGGAGCACAGAGGG + Intergenic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183406861 22:37634463-37634485 CAGTGTGGGCCCAGCAGAGAGGG - Intergenic
1184238813 22:43200825-43200847 CAGTGTGCCCAGGGCAAAGTTGG - Exonic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
1185248721 22:49788034-49788056 CAGTGTGGCCCGAGCCCACGGGG - Intronic
949119207 3:365414-365436 CAGTGTCTCCAGAGCCTAGAAGG - Intronic
949366058 3:3281927-3281949 CACTGGGGCCAGAGCATAGTAGG + Intergenic
950668654 3:14512243-14512265 CATGGGGTCCAGAGCACAGAGGG + Intronic
950874923 3:16263176-16263198 CAGTGTGACCAGAGCAGAGCAGG - Intronic
951033456 3:17907444-17907466 CAGTGTGGGCAGATCACAGGGGG + Intronic
951670156 3:25172298-25172320 CAGAGGGGCAAGAGCAGAGAAGG + Intergenic
952331233 3:32366176-32366198 CAGTGTGGGGGGCGCACAGAGGG + Intronic
952635545 3:35524974-35524996 CAGAGTGACTATAGCACAGAGGG - Intergenic
954038272 3:47865169-47865191 CAGTGTGGAAAGATCACAGCAGG + Intronic
955393385 3:58537126-58537148 CAGTGCGGACACAGGACAGAGGG - Exonic
955503825 3:59611381-59611403 CAGTGTGGCTGGAACACAGTGGG + Intergenic
955879310 3:63526874-63526896 CTGTGTGCTCAGAGCTCAGATGG + Intronic
955961579 3:64346317-64346339 CGGTGTGGCTGGAGCACAGTGGG + Intronic
956630911 3:71315784-71315806 CAAAGAGGCCAGAGAACAGAAGG + Intronic
956682096 3:71790439-71790461 CAGTGTGGCAGGAGCAGAGCTGG - Intergenic
957377618 3:79378998-79379020 TAGTGTCTTCAGAGCACAGAGGG - Intronic
959933993 3:112011258-112011280 CAGTGTGGCCCCTGCACAGTGGG - Intronic
959965684 3:112351863-112351885 CAGTGTGTGCAGAGATCAGATGG + Intronic
960358637 3:116683626-116683648 TAGTGTGGCCAGAGATCAGGAGG - Intronic
961262498 3:125613683-125613705 GAGTGTGCCAAGAGCCCAGAGGG - Intergenic
961262683 3:125615312-125615334 CAGTGTGGCTAGAACAAAGCAGG + Intergenic
961449773 3:126997437-126997459 CAGTGGGGGCACAGCAAAGACGG - Intronic
961512767 3:127413190-127413212 CAGTGAGGCCAGAGCCCAGGAGG - Intergenic
961829420 3:129615853-129615875 CCGTGTGGGCAGAGCAGAGGAGG + Intergenic
962288380 3:134107412-134107434 CAGTGTTGCCAGAGAAAAGGAGG - Intronic
962449493 3:135500792-135500814 CAGTGTGGCTAGAGTACAGCAGG + Intergenic
963258450 3:143169655-143169677 CAGTGGGGCCAGTTCCCAGAAGG - Intergenic
963618931 3:147579866-147579888 CAGTGTAGCCACAGAAGAGAAGG + Intergenic
963792913 3:149602617-149602639 CAGTGTGGCCAGTGTAAACAAGG - Intronic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
964596065 3:158430296-158430318 CAGTTTCCCCAGAGCTCAGAAGG + Intronic
966116378 3:176468265-176468287 CAATGTGGCTAGAACAAAGAAGG + Intergenic
966828690 3:183987569-183987591 CAGTGTTGCCAGAGAAGAAATGG - Intronic
967200536 3:187068897-187068919 CAGGGAGGCCTGAGGACAGAGGG - Intronic
967955258 3:194872812-194872834 GAATGTGGCAAGAGCCCAGAGGG - Intergenic
968663986 4:1810755-1810777 CAGTGTGGGCAGAGCACCTAAGG + Intergenic
969323108 4:6424911-6424933 CTGTGTGGCCACAGAACAGCAGG + Intronic
969593249 4:8133653-8133675 AGGTGTGTGCAGAGCACAGAGGG - Intronic
969749327 4:9098222-9098244 AAGTGTGGCCTGATCACACACGG + Intergenic
970159103 4:13171332-13171354 CAGTGTGGCTGGTGCAGAGAGGG - Intergenic
972387895 4:38585550-38585572 CAGTGTGACCAAGGCACAGTGGG - Intergenic
973246146 4:48013376-48013398 CAAGGTGGTCAGAGCACAGTTGG + Intronic
973272916 4:48279741-48279763 CAGTGTGTGCAGCCCACAGAGGG + Intergenic
973666600 4:53165571-53165593 CAGTGTGGCTGGAGCAAACAAGG - Intronic
975428613 4:74260054-74260076 CAGTCTGCCTAGAGCCCAGAGGG - Intronic
976024027 4:80665041-80665063 CAGTGTGTGCAGCCCACAGAGGG - Intronic
976686772 4:87822614-87822636 CAGAGAGGCCAGATGACAGATGG + Intronic
977057377 4:92210988-92211010 CAGTGTGTGCAGCCCACAGAGGG + Intergenic
979475984 4:121157733-121157755 CAGAGTGGCCACAGTCCAGAGGG + Intronic
980905442 4:138944144-138944166 CCGTGTAGCCAGAGCATGGAAGG + Intergenic
981638502 4:146908992-146909014 GACTGTGGGCAGAGCACAGAAGG - Intronic
981985917 4:150855624-150855646 CAGTTTGGGCAGGGCACATAGGG - Intronic
982194453 4:152896199-152896221 CAGTGAGGCCAGAGCATAATGGG + Intronic
983523439 4:168735250-168735272 CAGTGGGGCGAGAGCAGTGAGGG - Intronic
984678349 4:182577011-182577033 CAGACTGGCTAGAACACAGAGGG - Intronic
984855004 4:184187449-184187471 CAGTGTAGCAAGAGCAAAAAAGG - Intronic
985004020 4:185514672-185514694 CACTGTGGCCAGAACAGAGCCGG + Intronic
985500567 5:241849-241871 CAGTGTGACTAAGGCACAGAAGG + Intronic
985664748 5:1176287-1176309 CAGTGATGCCAGAGCCCAGGAGG - Intergenic
985937605 5:3108719-3108741 CAGTGTGGGTAGGGCAGAGACGG - Intergenic
985938104 5:3112011-3112033 CAGGCTGGCCAGAGCAGAGGTGG - Intergenic
986440412 5:7776527-7776549 CAGTGTCGTCAGAGCACTCAAGG - Intronic
986748346 5:10762842-10762864 CAGGGTGGCCAGAGAACTGGAGG - Intergenic
988616419 5:32779469-32779491 CGGGGTGGCCAGAGAACGGAGGG - Intronic
988716842 5:33836820-33836842 CAAGGTGGCCAGAGCCTAGAGGG + Intronic
988929835 5:36027189-36027211 CAGAGTGTCCAGAAAACAGATGG + Intergenic
989419496 5:41219954-41219976 GAGTGTGGCCAAAGTAAAGAGGG + Intronic
989516773 5:42353312-42353334 CAGTGTGTGCAGGCCACAGAGGG + Intergenic
990279830 5:54238262-54238284 CAGTGTTTCCAGGGCACAAAGGG - Intronic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
992292516 5:75293562-75293584 CAGTGTGTGCAGCCCACAGAGGG - Intergenic
992679672 5:79141452-79141474 CAGGGTGGGCAGATCACATAAGG - Intronic
995913172 5:117212389-117212411 CAGTGTGCCCAGAGCTCACATGG + Intergenic
996036051 5:118759914-118759936 CAGTGTGGCTAGAGTAAAGCAGG - Intergenic
996273465 5:121636853-121636875 CAGTGTGGCTAGAACACAGTAGG - Intergenic
996313095 5:122129056-122129078 CAGTGTGGCCAGAATAAAGCAGG - Intergenic
996566143 5:124881256-124881278 CACAGAGGCCAGAGTACAGAGGG - Intergenic
997241936 5:132314166-132314188 CACTGTGGCCAGTACACAGGTGG + Intronic
997360504 5:133291777-133291799 GGGTGTGGACGGAGCACAGAGGG + Intronic
997699622 5:135887836-135887858 CAGTGTGGCCATTTTACAGATGG - Intronic
997998525 5:138605759-138605781 CAGAATGTGCAGAGCACAGAGGG - Intergenic
998066435 5:139163057-139163079 TACTGTGTCCAGAACACAGAAGG + Intronic
998597801 5:143552234-143552256 CAGTGGGTCCAGAGAACACAAGG + Intergenic
999175590 5:149629599-149629621 CAGTGTGGCCGGAGAAGAAAGGG + Intronic
1000166759 5:158657314-158657336 CAGGGTGGCTGGACCACAGATGG - Intergenic
1000398234 5:160798217-160798239 CACTGTGGCTAGAGCTCAGCTGG + Intronic
1000922978 5:167160372-167160394 CAGTGAGGCTGGAGCACAGCAGG - Intergenic
1002569370 5:180131307-180131329 ACCTGTGTCCAGAGCACAGAAGG - Intronic
1002985768 6:2189582-2189604 CAGAGTGAGCAGAGCACAGAGGG - Intronic
1003277657 6:4666154-4666176 AACTGAGGCCAGAGCACAGTGGG - Intergenic
1003288242 6:4753839-4753861 CCTAGTGGCCAGAGCAAAGAGGG - Intronic
1003308579 6:4949456-4949478 TAGTTTGGCCAGAGTACAGCAGG - Intronic
1003325878 6:5090467-5090489 CAGTGTCTCCAGAGCTCAGTGGG - Intergenic
1003890635 6:10560914-10560936 CTGTGTGGCTTGTGCACAGATGG + Intronic
1003994307 6:11523430-11523452 GAGTGTGGCCAGAGAACCAAGGG + Intergenic
1005822297 6:29607891-29607913 CAGTGAGGCCAGAGTGCAGCTGG - Intronic
1006395642 6:33785495-33785517 GAGTGTGTCCAGATCAGAGAAGG + Intronic
1006939388 6:37742002-37742024 CCGTGTAGCCAGTGCACAGTAGG + Intergenic
1006976658 6:38108646-38108668 CAGGATGGCCAGAACACAGCAGG - Intronic
1007238967 6:40411525-40411547 CAGTGGGGCCAGACCCCACAGGG - Intronic
1008572822 6:52831269-52831291 CAGGGTGGCCTGAGAGCAGAGGG + Intergenic
1008579769 6:52896235-52896257 CAGGGTGGCCTGAGAGCAGAGGG + Intronic
1008761960 6:54862282-54862304 CAGTCTGGGCTGAGCACAGTGGG + Intronic
1009690873 6:67030962-67030984 CAGTGTGGCCAGAGCGGACGAGG - Intergenic
1010574866 6:77518339-77518361 CAGTGGGTACAGACCACAGAGGG + Intergenic
1010598729 6:77797745-77797767 CAGTGTGGCTAGAACAAAGCAGG - Intronic
1011860758 6:91753255-91753277 CAGTGTGCCCAGCTCACATAAGG + Intergenic
1013389265 6:109666776-109666798 CAGCCTGGCCAGAGGTCAGATGG - Intronic
1014007870 6:116442202-116442224 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
1015490129 6:133815461-133815483 TAATGTGCCCAGGGCACAGAAGG - Intergenic
1016313793 6:142763328-142763350 CATTGTCGTCTGAGCACAGATGG - Intronic
1016912659 6:149214570-149214592 CAGTGTGACTGGAGCACAGAGGG - Intergenic
1017948544 6:159116459-159116481 CCGTGGGGCCAGAGCCCAAAAGG + Intergenic
1018057848 6:160067924-160067946 CTCAGTGGCCTGAGCACAGACGG + Intronic
1018141659 6:160843765-160843787 CAGTGTACCCAGAGAATAGATGG - Intergenic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1018942128 6:168315430-168315452 CTGTGTGGCCAGTCCAGAGAGGG - Intronic
1018986139 6:168638543-168638565 GAGGGTGGGCAGAGCACACAGGG + Intronic
1020367321 7:7394247-7394269 CAGTGGGGGCAGCACACAGAGGG - Intronic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1022804107 7:33804633-33804655 CAGGGTGGCCAAAGCAACGAAGG - Intergenic
1023042600 7:36185102-36185124 CTGTGTGGGGAGAGCACAAAGGG - Intronic
1023757000 7:43428729-43428751 TAGAGTGCCCAGAACACAGAAGG - Intronic
1023851761 7:44154036-44154058 CAGTGTGCCCATGCCACAGATGG - Intronic
1023869211 7:44253945-44253967 CAGGGTGGGCAGAGCCCAGTGGG + Intronic
1024924723 7:54600762-54600784 ATGTGTGGGCAGAGCACAGGGGG - Intergenic
1026050241 7:66940603-66940625 CAGTGTGGCCAAAGCCCAGGAGG + Intronic
1026127085 7:67588451-67588473 CAATGTGGGCAGGGCTCAGAGGG - Intergenic
1026135375 7:67656207-67656229 CAGTGTGTCCAGAGATCACATGG + Intergenic
1026422611 7:70256349-70256371 CAGTGGGCCAAGAGAACAGAGGG + Intronic
1026461393 7:70618331-70618353 CAGGGTGACCAGATCACAGGAGG - Intronic
1029467787 7:100736988-100737010 CAGTGTTTCCAGAGCACATCGGG - Exonic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1029675980 7:102069194-102069216 CAGGGTGGAAAGAGCACAGGAGG - Intronic
1030318501 7:108140691-108140713 CAATGTGGCTAGAGCAGAGTGGG + Intergenic
1030348478 7:108457670-108457692 CTGTGAGGCCAGAGCACATTTGG - Intergenic
1030675210 7:112377858-112377880 GCCTGTGGCCAGAGTACAGATGG - Intergenic
1030968004 7:116017635-116017657 CAGTATGGCTAGACCACAGTAGG - Intronic
1032453135 7:132051888-132051910 CAGGGAGGCAAGAGGACAGACGG + Intergenic
1033552112 7:142456881-142456903 GAGTAAGGCCAGGGCACAGATGG + Intergenic
1033554380 7:142475821-142475843 GAGTAAGTCCAGAGCACAGATGG + Intergenic
1033951315 7:146788193-146788215 CCGTGTGGCCTGAGAGCAGAGGG + Intronic
1035384285 7:158459877-158459899 CTGTGTGCCGAGAGCACAGGAGG + Intronic
1035384351 7:158460315-158460337 CTGTGTGCCAAGAGCACAGGAGG + Intronic
1035599777 8:890801-890823 CAGGGTGGCTTGGGCACAGAGGG - Intergenic
1035756110 8:2034211-2034233 AGGTGGGGCCAGAGCCCAGATGG - Intergenic
1037162867 8:15793937-15793959 CAGTGTGGCTAGAGCAAAGTGGG + Intergenic
1037296981 8:17412302-17412324 CAGAGTGGCCATAGCTCAGGTGG - Intronic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1037952637 8:23028841-23028863 CAGTGTGTGCCCAGCACAGAAGG - Intronic
1037967586 8:23146156-23146178 CAGTGTGTGCCCAGCACAGAAGG - Intronic
1038622601 8:29158009-29158031 CAGTGTGCTCAAAGAACAGATGG - Intronic
1039216550 8:35278235-35278257 GAGTGTGGCCAGAGGGCAGCCGG - Intronic
1039989314 8:42474832-42474854 CAGTGTCGTGAGAGCACAGCCGG + Intronic
1040948084 8:52906082-52906104 CAGTGTACCCTTAGCACAGAGGG + Intergenic
1041468360 8:58180605-58180627 GAGTGGGGCCAGAGAGCAGAAGG + Intronic
1041618325 8:59934433-59934455 CAGTGTGGCAGGAGCATAGTTGG + Intergenic
1041677578 8:60550901-60550923 CAATGTGGCTAAAGCACAGGAGG - Intronic
1041815793 8:61969040-61969062 CAGTGTGTGCAGCCCACAGAGGG - Intergenic
1041836553 8:62223252-62223274 CAGTGGGTGCAGACCACAGAGGG + Intergenic
1041914391 8:63125445-63125467 CAGTAGGGGTAGAGCACAGAGGG - Intergenic
1042020406 8:64368393-64368415 CAGGGTGCCCAGAGCAGAGTTGG + Intergenic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045350328 8:101332430-101332452 CACTGTGGACAGAGCCCACAGGG + Intergenic
1045578255 8:103449150-103449172 GTGGTTGGCCAGAGCACAGAGGG - Intergenic
1046141388 8:110097283-110097305 CAGAGTAGCCAGAGTACAAAGGG - Intergenic
1046774973 8:118154261-118154283 CAGTGTGATGAGAGGACAGATGG - Intergenic
1047488024 8:125350434-125350456 CAGTGTGCCTTGAGCACAGTGGG + Intronic
1047495406 8:125405282-125405304 CAGAGGGGCCAGAGCACATGGGG + Intergenic
1048166590 8:132067093-132067115 TACTGTGGCCAAAGCACAGAGGG + Intronic
1048177015 8:132162061-132162083 CACTCTGCCAAGAGCACAGAGGG - Intronic
1048325508 8:133436134-133436156 CAAGGTGGGCAGAGGACAGAAGG + Intergenic
1048509633 8:135050528-135050550 CTTTGTGGCCTGAGCACAGAAGG + Intergenic
1049148629 8:141020152-141020174 CAGTAGGGCCAGCACACAGAAGG - Intergenic
1049290433 8:141798718-141798740 CACTGTGTCCAGAGCTAAGAGGG + Intergenic
1049433697 8:142576688-142576710 CAGAGTGGACAGAACAGAGATGG + Intergenic
1050141631 9:2521820-2521842 CAGTGGGGGCAGCCCACAGAGGG - Intergenic
1050407640 9:5327048-5327070 CAGTGGGGGCAGCCCACAGAGGG + Intergenic
1050814624 9:9794468-9794490 CAATGTGGCTAGAGCAGAGAAGG + Intronic
1051031839 9:12690155-12690177 CACTGTGGAAAAAGCACAGAAGG - Intronic
1052380339 9:27764142-27764164 AAGTGTGGCCAGAGCATTGCAGG - Intergenic
1052560403 9:30077450-30077472 CAGTGTGGCTAGAACAAAGCAGG - Intergenic
1052893336 9:33723818-33723840 CAGAGTGTGCAGAGCACAGCTGG + Intergenic
1053121891 9:35553699-35553721 AAGTGTGGCTGGAGCACAGTGGG + Intronic
1054978152 9:71172188-71172210 CACTGTGCCCAGCGCATAGAAGG + Intronic
1055700573 9:78940658-78940680 GAGACTGGCCAGATCACAGAAGG - Intergenic
1055800103 9:80025308-80025330 CAGTGTGGCCAGAATAAAGCAGG - Intergenic
1056568317 9:87794228-87794250 CAGTGTGGCCAGAGCATCCTGGG + Intergenic
1056570186 9:87808056-87808078 CAGTGTGGCCAGAGCATCCTGGG + Intergenic
1058546817 9:106069425-106069447 CAATATGGCTAGACCACAGATGG + Intergenic
1058567137 9:106298054-106298076 CAGTGTAGTCAGAGAAAAGAGGG + Intergenic
1058906638 9:109487319-109487341 CACTGTGGCAAGAGCAGGGAGGG + Intronic
1060456950 9:123807560-123807582 ATCTGTGGCAAGAGCACAGATGG - Intronic
1061471554 9:130830716-130830738 GAGAGTGCCCAAAGCACAGAAGG - Intronic
1061629544 9:131863437-131863459 CAGTGGGGGCAGATCCCAGAGGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061923895 9:133796730-133796752 CAGTGTGGCCAGTGCAGACACGG - Intronic
1062107253 9:134762458-134762480 CCATGGGGCCAGAGCACAGGAGG + Intronic
1062123630 9:134847901-134847923 TGGTGTGGCCTGAGCAGAGATGG + Intergenic
1062729825 9:138102674-138102696 CAGCGAGGCCAGGGCACAGTGGG - Intronic
1185642785 X:1597794-1597816 CTGCCTGGCCAGACCACAGAGGG + Intronic
1189877995 X:45456668-45456690 GAGAGTGATCAGAGCACAGAAGG - Intergenic
1190572842 X:51802138-51802160 AAATGTGGTCAGAGCAAAGAAGG - Intergenic
1192541254 X:71975130-71975152 GAGTGTCGCCAGGGCACAGATGG - Intergenic
1194023317 X:88721200-88721222 CAGTGTGGCTAGAACAAAGCAGG - Intergenic
1194391078 X:93319254-93319276 CAGTGAGTGCAGACCACAGAGGG + Intergenic
1195384628 X:104302595-104302617 AAGTGTGTCCAGATCATAGATGG - Intergenic
1195760335 X:108238992-108239014 CAGAATGGACAGACCACAGAAGG - Intronic
1196483421 X:116178023-116178045 CAGTGTGTACAGAACACAGTTGG + Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1197261550 X:124324906-124324928 CAAGTTAGCCAGAGCACAGAAGG + Intronic
1197878969 X:131144407-131144429 CAGTGAGGATAGAGAACAGATGG - Intergenic
1198024526 X:132692331-132692353 CAGTGTGGTCAGTGCAGTGATGG + Intronic
1198304394 X:135366289-135366311 GAATGTGGACAGGGCACAGAGGG - Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1199565039 X:149206936-149206958 GACAGTGGCCAGATCACAGAGGG + Intergenic