ID: 1077905641

View in Genome Browser
Species Human (GRCh38)
Location 11:6530732-6530754
Sequence TGAACCCCCTGTACAAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077905641_1077905652 30 Left 1077905641 11:6530732-6530754 CCTCCTCTTGTACAGGGGGTTCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1077905652 11:6530785-6530807 TGATTGTTTTGTCTTCTCTCTGG 0: 1
1: 1
2: 5
3: 45
4: 428
1077905641_1077905648 -2 Left 1077905641 11:6530732-6530754 CCTCCTCTTGTACAGGGGGTTCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1077905648 11:6530753-6530775 CAGGCGGGCAAGGCAGGAACCGG 0: 1
1: 0
2: 1
3: 25
4: 278
1077905641_1077905650 2 Left 1077905641 11:6530732-6530754 CCTCCTCTTGTACAGGGGGTTCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1077905650 11:6530757-6530779 CGGGCAAGGCAGGAACCGGGAGG 0: 1
1: 1
2: 0
3: 15
4: 173
1077905641_1077905649 -1 Left 1077905641 11:6530732-6530754 CCTCCTCTTGTACAGGGGGTTCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1077905649 11:6530754-6530776 AGGCGGGCAAGGCAGGAACCGGG 0: 1
1: 0
2: 0
3: 22
4: 312
1077905641_1077905647 -8 Left 1077905641 11:6530732-6530754 CCTCCTCTTGTACAGGGGGTTCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1077905647 11:6530747-6530769 GGGGTTCAGGCGGGCAAGGCAGG 0: 1
1: 0
2: 2
3: 19
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077905641 Original CRISPR TGAACCCCCTGTACAAGAGG AGG (reversed) Intronic
901336328 1:8452182-8452204 TGATCTCCCTGTCCAAGAGCAGG + Intronic
907800839 1:57763771-57763793 TGAATCCCCTGTACAGTAAGCGG + Intronic
907834119 1:58093169-58093191 TCAATCTCCTGTACAAGTGGAGG + Intronic
908877542 1:68695133-68695155 TGAACCTCCTGTGCCTGAGGTGG - Intergenic
912647375 1:111406666-111406688 TGATCCACCTGCACAAAAGGAGG + Intergenic
1066541411 10:36450645-36450667 AGAATCCACTGAACAAGAGGCGG + Intergenic
1072033528 10:91543255-91543277 TGAAAGCCCTGTACAAGTAGTGG + Intergenic
1074382765 10:112993669-112993691 TGAATCCCCTCTACAAGAGAGGG + Intronic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1078928917 11:15898354-15898376 TGATCCCCCTTTATAGGAGGAGG - Intergenic
1080002086 11:27361741-27361763 TGAACACCCTGTACTGAAGGGGG + Intronic
1085584573 11:77689816-77689838 TGAATCCCCTTTTAAAGAGGAGG + Intronic
1088693108 11:112344590-112344612 TGATCCCCCTGTGGCAGAGGAGG + Intergenic
1099576944 12:84393807-84393829 TGAAAACCCTGAAAAAGAGGTGG - Intergenic
1109961332 13:69636571-69636593 TGAACCCCCTGTCAAAGTGCTGG + Intergenic
1111041529 13:82756203-82756225 TGAACCTCCTGTACATGAGAAGG + Intergenic
1113786291 13:113003616-113003638 GGACCACCCTGGACAAGAGGAGG + Intronic
1116902630 14:50376448-50376470 TGAACATCCTGTAATAGAGGAGG + Intronic
1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG + Intronic
1133616602 16:7482838-7482860 TGAACACCATGTACAGGAGATGG + Intronic
1137351618 16:47718474-47718496 TGAACCCCATGAACCAGAAGTGG + Intergenic
1137976767 16:53038683-53038705 TGCACCCCCTGTACAACAACGGG + Intergenic
1143447313 17:7017100-7017122 TGAAACCCCTATACAAGGGAGGG - Intronic
1147594678 17:41709197-41709219 AAAACCCCCTGTACACCAGGAGG + Intergenic
1148247471 17:46043518-46043540 TGTACCTCCAGTACAACAGGAGG - Intronic
1152604465 17:81282197-81282219 TGAACACGGTGTAGAAGAGGAGG + Exonic
1157762998 18:50277975-50277997 TGTATCCCCTGCACGAGAGGGGG - Intronic
926108691 2:10168451-10168473 TAAACCCCCTCTTCAAGAAGAGG - Intronic
929506030 2:42528807-42528829 TCAACCCCCAGAACAAGAAGAGG + Intronic
932705401 2:74020688-74020710 TCAAGCCCTTGAACAAGAGGTGG - Intronic
932775843 2:74527936-74527958 TGCACTCCGTGTACAACAGGTGG - Exonic
939564954 2:143775934-143775956 TGAACCCCCTGTGCATGGGCTGG + Intergenic
943221276 2:185109596-185109618 TGGACCCCCTGTTCAATAAGTGG + Intergenic
945480402 2:210338311-210338333 TGAAGCCCCAGTACAGGAGAGGG - Intergenic
1181694026 22:24584122-24584144 TGAACACCCTGTTCCAGAGTAGG + Intronic
1182124083 22:27803962-27803984 TGAACCTCCTGGACAAAAAGCGG + Intergenic
949231547 3:1756600-1756622 TGAAGCCCCAGTACATGAGAGGG + Intergenic
950927947 3:16761332-16761354 TGAACACCCAGGACAGGAGGTGG - Intergenic
952866423 3:37858269-37858291 TGTACCACCTGTACAAGAACAGG - Intergenic
953539822 3:43807712-43807734 TCAACCCCTTTTACAAGAGCTGG + Intergenic
953957073 3:47239968-47239990 TGAACCACCTGTCCCAGAGTTGG + Intronic
954087434 3:48256418-48256440 TGAACGCCCTGTTCCAGGGGAGG + Intronic
955425647 3:58787010-58787032 TGTACCCCCTGTAGATAAGGGGG + Intronic
971121287 4:23707656-23707678 TGAAACCCTGGTACAAGATGAGG + Intergenic
977139747 4:93353886-93353908 TGAGCCCCATGTATAAGAGTAGG + Intronic
980020439 4:127703144-127703166 TGAACTGCCTGTACAATAGCAGG - Intronic
984833848 4:184000642-184000664 TGAACCCAGTGTTCAAGAGTAGG - Intronic
986196186 5:5538015-5538037 TGACCCCCCAAAACAAGAGGAGG - Intergenic
987066744 5:14297274-14297296 TGAACCCCCAGCCCACGAGGTGG + Intronic
988796605 5:34657358-34657380 TGAGCCCCCTCCACAAAAGGGGG - Intronic
990412149 5:55552108-55552130 TCAATCCCATGTACATGAGGTGG + Intergenic
992749531 5:79849564-79849586 TGCAGCCCCTGGACAAGTGGCGG - Intergenic
995622397 5:114040245-114040267 TGAAGCCCCTGTATATGAGAGGG - Intergenic
998536102 5:142932229-142932251 TGAAACCAGTGTACCAGAGGTGG + Intronic
1001473144 5:172029891-172029913 TGGACCTGCTGCACAAGAGGTGG - Intergenic
1006735050 6:36267609-36267631 TGAAGCCCATGTACAGCAGGTGG + Intronic
1015716004 6:136192426-136192448 TGAACCCCCTGTTCAAGTTTGGG - Exonic
1016435654 6:144034508-144034530 TGAACCCCCTGAATGAGAGGAGG - Intronic
1017204534 6:151790460-151790482 TGAACCCCTTCCACAACAGGTGG - Intronic
1021898722 7:25262304-25262326 TGAACCCTCTGAATGAGAGGAGG - Intergenic
1036498520 8:9292795-9292817 TGCAACCCCTGTACATGAAGAGG + Intergenic
1038178671 8:25205571-25205593 TCAAATCCCTGTAAAAGAGGAGG - Intronic
1038699046 8:29832552-29832574 TGAAAGCCCTGTAGAGGAGGTGG + Intergenic
1047713539 8:127575113-127575135 TGAGCCCCTTGTACCAGCGGAGG + Intergenic
1062125298 9:134857260-134857282 TGAAGCACCTGGACAAGAAGCGG + Intergenic
1062723843 9:138059847-138059869 AGAACCCCCTGGACATGTGGAGG + Intronic
1190407390 X:50101496-50101518 AGAAGCCCCTTTTCAAGAGGAGG - Intergenic
1194882230 X:99268103-99268125 TGAACCCCTTTTACAATAGCTGG - Intergenic
1196148311 X:112344254-112344276 TAAATCCTCTGTAAAAGAGGTGG - Intergenic