ID: 1077905647

View in Genome Browser
Species Human (GRCh38)
Location 11:6530747-6530769
Sequence GGGGTTCAGGCGGGCAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 288}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077905641_1077905647 -8 Left 1077905641 11:6530732-6530754 CCTCCTCTTGTACAGGGGGTTCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1077905647 11:6530747-6530769 GGGGTTCAGGCGGGCAAGGCAGG 0: 1
1: 0
2: 2
3: 19
4: 288
1077905634_1077905647 12 Left 1077905634 11:6530712-6530734 CCAGTGGGCCACTAAAACTCCCT 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1077905647 11:6530747-6530769 GGGGTTCAGGCGGGCAAGGCAGG 0: 1
1: 0
2: 2
3: 19
4: 288
1077905640_1077905647 -7 Left 1077905640 11:6530731-6530753 CCCTCCTCTTGTACAGGGGGTTC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1077905647 11:6530747-6530769 GGGGTTCAGGCGGGCAAGGCAGG 0: 1
1: 0
2: 2
3: 19
4: 288
1077905635_1077905647 4 Left 1077905635 11:6530720-6530742 CCACTAAAACTCCCTCCTCTTGT 0: 1
1: 0
2: 2
3: 19
4: 223
Right 1077905647 11:6530747-6530769 GGGGTTCAGGCGGGCAAGGCAGG 0: 1
1: 0
2: 2
3: 19
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077905647 Original CRISPR GGGGTTCAGGCGGGCAAGGC AGG Intronic
900127482 1:1075047-1075069 GGGGCTGAGGCTGGCAGGGCTGG + Intergenic
900148862 1:1169612-1169634 GGGGCTGAGGCGGGCGGGGCCGG + Intergenic
902978294 1:20105204-20105226 TTGGTTCAGGCTGGAAAGGCGGG + Intergenic
903328916 1:22586946-22586968 GGGGGCCAGGTGGGCAAGCCAGG + Intronic
904454589 1:30639811-30639833 GGGGGTCAGGGTGGCAGGGCTGG + Intergenic
904487550 1:30837228-30837250 TGGGTTCAGTCTGGAAAGGCGGG + Intergenic
905227202 1:36486977-36486999 GGGGTCCAGGTGGGCAAGCTGGG + Intergenic
905767427 1:40612865-40612887 CAGGTACAGGCAGGCAAGGCTGG - Intergenic
906106136 1:43293774-43293796 GGGGCCCAGGCAGGCAGGGCTGG - Intergenic
906306911 1:44725271-44725293 GGGCTGCAGGCAGGAAAGGCGGG - Exonic
907119040 1:51992534-51992556 GGGGTTGAGGGGGGTATGGCTGG - Intergenic
908523400 1:64966157-64966179 GCGGCTCGGGCGGGGAAGGCGGG - Intronic
911112913 1:94210789-94210811 GGGCTTTGGGAGGGCAAGGCAGG + Intronic
912421504 1:109545199-109545221 GGGGGTCAGACGGGCGAGGGTGG + Exonic
913960407 1:143334546-143334568 GTGGTGCGGGCGGGGAAGGCCGG - Intergenic
914355086 1:146877918-146877940 GGGGTTCTGGGGGGCAAAGAAGG - Intergenic
914777042 1:150746823-150746845 GGAGGTGAGGCTGGCAAGGCAGG + Intronic
914861957 1:151393975-151393997 GGGGTTCATGTTGGCCAGGCTGG - Intergenic
914906108 1:151746267-151746289 GGACTTCAGGAGGCCAAGGCGGG - Intergenic
915596012 1:156896857-156896879 GGAGGTCAGGAGGGCAAGTCTGG + Intronic
916448424 1:164895308-164895330 GGGGGTCAAGTGGGCAAGGGTGG + Intronic
917174179 1:172213582-172213604 GCGCTTCAGGAGGCCAAGGCAGG + Intronic
919640825 1:200042114-200042136 GGGATTCAGGCTGGCACCGCTGG + Intronic
920300495 1:204985863-204985885 AGGGGTCAGGCAGGCAGGGCTGG - Intronic
920331435 1:205211261-205211283 GGGCTGCAGGCGGGTAAGGAGGG - Exonic
920837564 1:209525832-209525854 GGAGTTGAGGTGAGCAAGGCTGG - Intergenic
922444729 1:225687570-225687592 GTGCTTCAGGAGGCCAAGGCAGG + Intergenic
923040389 1:230315538-230315560 GGGGTCCAGGAGGGCAAGAATGG - Intergenic
924486407 1:244487695-244487717 GGGATTAAGGAGGGGAAGGCTGG + Intronic
1064770726 10:18719687-18719709 GCGCTTCAGGAGGCCAAGGCAGG - Intergenic
1065013004 10:21436426-21436448 GTGGCTCAGGGGGGCCAGGCTGG + Intergenic
1065013169 10:21437752-21437774 GGAGTTTTGGAGGGCAAGGCAGG - Intergenic
1066059522 10:31709419-31709441 GGGGTTGAGGAGGGTAAGGAAGG + Intergenic
1067051712 10:43025224-43025246 TGGGTGCAGGCTGGCAAGGCTGG + Intergenic
1067941117 10:50658350-50658372 GGAGAGCAGGCTGGCAAGGCAGG + Intergenic
1070862331 10:79683222-79683244 GGAGAGCAGGCCGGCAAGGCAGG + Intergenic
1071845513 10:89517555-89517577 GGGGTTTGGGAGGCCAAGGCAGG - Intronic
1072607934 10:96999535-96999557 GGGGTTCTGGTGGGCAACGGGGG - Exonic
1073299390 10:102461641-102461663 GGGGTTCAAGGGGGCAAGGGTGG + Intronic
1075002695 10:118809798-118809820 GGGGTTAAGACGGGGGAGGCAGG + Intergenic
1077140405 11:1021824-1021846 GGGGCTCAGGAGGGCAATGCAGG - Intronic
1077226833 11:1442252-1442274 AGGGTGCAGGAGGGCATGGCAGG + Intronic
1077905647 11:6530747-6530769 GGGGTTCAGGCGGGCAAGGCAGG + Intronic
1079419273 11:20270932-20270954 GGGGTTGGCGAGGGCAAGGCAGG - Intergenic
1080439881 11:32282839-32282861 TGAGTTCAGGAGGTCAAGGCTGG + Intergenic
1081741944 11:45447052-45447074 GGAGGTGAGGCGGGCAGGGCAGG + Intergenic
1081866193 11:46361938-46361960 GGGGAGCAGGTGGGCCAGGCTGG - Intronic
1088283417 11:108161133-108161155 GGGCTGCAGGCAGGCAAGTCTGG + Exonic
1089299351 11:117489264-117489286 GGGGTGCAGGCGGGAGAGCCGGG + Intronic
1089354257 11:117839695-117839717 GGGGTTCAGGCGGGAAGGATGGG - Intronic
1089605781 11:119640452-119640474 GAGGATCAGGAGGGAAAGGCAGG + Intronic
1089677330 11:120098668-120098690 GGCGTTCAGGCTGCCATGGCGGG - Intergenic
1089732781 11:120529707-120529729 GTGGTTGAGGTGGGAAAGGCAGG - Intronic
1089966784 11:122659927-122659949 AGGGTTGAGGCCAGCAAGGCTGG + Intronic
1090060404 11:123459776-123459798 GAGGTTCTGGAGGGCAGGGCTGG + Intergenic
1090267032 11:125359709-125359731 AGGCTTCAGGCGGGCCCGGCAGG - Intronic
1091387308 12:103448-103470 GGGGCTCAGGCAGGAGAGGCGGG + Intronic
1091399751 12:174798-174820 GGGCTCCATGCGGGCCAGGCAGG - Exonic
1095607225 12:44083648-44083670 GGGCTTTAGGAGGACAAGGCAGG - Intronic
1095967946 12:47882178-47882200 GGGGTGAAGGCTGGAAAGGCTGG + Intronic
1096517310 12:52164118-52164140 GTGGTGCAGGCTGGCAGGGCAGG + Intergenic
1097175056 12:57137857-57137879 GAGGCACAGGAGGGCAAGGCTGG - Intronic
1098392348 12:69982932-69982954 GGGGTTCAGGGAGCCAAGGTTGG - Intergenic
1099125354 12:78748661-78748683 GGGGTTGGGGCGGGGAAGTCAGG + Intergenic
1099956235 12:89354169-89354191 GGGGTTTAGGGAGGGAAGGCCGG - Intergenic
1101736288 12:107465710-107465732 TGAGGTCAGGTGGGCAAGGCTGG - Intronic
1102815045 12:115858752-115858774 GGGGTACAGGCAGCCAGGGCTGG + Intergenic
1103134224 12:118493710-118493732 GGGCTTAAGGGGGTCAAGGCAGG - Intergenic
1104076400 12:125393622-125393644 GGGGTTCAGGCAGGAACAGCTGG + Intronic
1104188426 12:126454829-126454851 GGGGTGGAGGTGGGGAAGGCAGG - Intergenic
1104229908 12:126874631-126874653 GGGTTTCACACTGGCAAGGCAGG - Intergenic
1105048320 12:133025693-133025715 GAGCTTCAGGAGGCCAAGGCAGG + Exonic
1106498583 13:30306437-30306459 AGTGTTCAGGCTGGCAAGGGGGG + Intronic
1109789736 13:67230685-67230707 GGTGGTCCGGCGGGCAAGGGCGG + Intergenic
1112901037 13:104357096-104357118 GGGGTTGAGGGGTGGAAGGCTGG - Intergenic
1113424982 13:110200363-110200385 GGGGTCCAGGGAGGCAAGGCTGG + Intronic
1113813929 13:113158972-113158994 GGGATTCAGCCGGGAAAGGCCGG + Intronic
1114304892 14:21413639-21413661 GCGCTTCAGGAGGCCAAGGCAGG - Intronic
1114923665 14:27365533-27365555 GCGCTTCAGGAGGCCAAGGCGGG + Intergenic
1115754198 14:36517338-36517360 GGAGTTCAGGTGGGACAGGCTGG + Exonic
1117046285 14:51816597-51816619 GGGGTTGTGGCGGGCCAGGGTGG + Intergenic
1117309779 14:54509895-54509917 GGGGCTCAGCCGGGCTGGGCTGG + Exonic
1117394815 14:55298659-55298681 GGGGGTAAGGCCGGCAAGGGCGG + Intronic
1117818296 14:59620889-59620911 GGGGTTCAGGCTGGGAATGACGG + Intronic
1119946610 14:78701814-78701836 GAGGTTCAGACTTGCAAGGCAGG - Intronic
1120356180 14:83436806-83436828 GGGGGGCATGCTGGCAAGGCAGG + Intergenic
1121050305 14:90815926-90815948 GGGGTTCAAGCGTGCAGGGCGGG - Intronic
1121310956 14:92934764-92934786 GGGGTTCACTCGGGCCAGCCTGG - Intronic
1122021283 14:98839968-98839990 GGGGTTCAGGCAGGAAGAGCTGG + Intergenic
1122059286 14:99125896-99125918 GGGCATCAGGGGGCCAAGGCTGG - Intergenic
1122796929 14:104210703-104210725 GGGGTTCCGGGGGGCAGGGCTGG + Intergenic
1126106071 15:45147851-45147873 GGGGTTCAGGCAGGCAGGCGGGG + Intronic
1128148175 15:65344347-65344369 GGGGTTCAGGGGCCCAAGGCAGG - Intronic
1130557584 15:84933614-84933636 GGGGTTGAGGGGTGCCAGGCAGG + Intronic
1132222277 15:100113824-100113846 GGGGTTCTGCCGTGCCAGGCAGG + Intronic
1132700328 16:1219554-1219576 AGGCTGCAGGTGGGCAAGGCTGG - Intronic
1135109618 16:19680663-19680685 GCAGTTCAGGAGGCCAAGGCAGG + Intronic
1136224028 16:28846648-28846670 GGGAGTCAGGCGGGCTAGGCCGG + Intronic
1137056993 16:35750721-35750743 GGGGGTCAGGAGGGGAAGGTTGG - Intergenic
1137574965 16:49593496-49593518 AGGGTTCTGGCGGGAGAGGCAGG - Intronic
1139279626 16:65759266-65759288 GGCCTTCAGGAGGGCAGGGCTGG - Intergenic
1139327116 16:66161175-66161197 GGGGTGCAGGTGGAGAAGGCTGG - Intergenic
1139511347 16:67430239-67430261 GGGGTTCAGGGGAGCAAGGCAGG + Intergenic
1139978930 16:70837611-70837633 GGGGTTCTGGGGGGCAAAGAAGG + Intronic
1140760764 16:78106660-78106682 GTACTTCAGGAGGGCAAGGCAGG - Intronic
1141365681 16:83440531-83440553 GAGCTTCAGGAGGCCAAGGCAGG + Intronic
1141449071 16:84085051-84085073 GGGGTTCTGGCGTGAAAGGGGGG - Exonic
1141958882 16:87391839-87391861 GGGGCTGAGGCGCGCAGGGCAGG - Exonic
1142177228 16:88650839-88650861 GGGCGCCAGGCGGGCCAGGCCGG - Intronic
1142420304 16:89965987-89966009 TGGGTCCTGGCGGGCCAGGCGGG - Exonic
1142505035 17:357860-357882 GGGCCTTAGGCAGGCAAGGCAGG - Intronic
1142728824 17:1836739-1836761 TGAGTTCAGGAGGTCAAGGCTGG - Intronic
1142743137 17:1942109-1942131 GGGGCTGAGGAGAGCAAGGCCGG + Intronic
1143110229 17:4548784-4548806 GGGGGCCTGACGGGCAAGGCTGG + Intronic
1143954830 17:10660062-10660084 GGTGTGCAAGCGGGCAAGCCGGG - Intergenic
1144439157 17:15265835-15265857 GGGGTCTAGGCAGACAAGGCAGG - Intergenic
1144682656 17:17205826-17205848 GGGGTCCAAGCGGAGAAGGCCGG - Intronic
1144853683 17:18256881-18256903 GGGGTTTGGGCGGGCAGGGGAGG - Intronic
1145050230 17:19654296-19654318 GGGGTGCAGGCGCGCAGCGCTGG - Intronic
1145994436 17:29097355-29097377 GGGGTTGAGGCAGACAAGGGAGG + Intronic
1146664693 17:34691162-34691184 GTGCTTCAGGAGGCCAAGGCAGG + Intergenic
1147326659 17:39672931-39672953 GGGGTGCATGCAGGCAAGGTGGG + Intronic
1147445242 17:40471325-40471347 GGGGGTCAGGCAGACAAGCCAGG - Intergenic
1147580505 17:41624915-41624937 AGGGTTGAGGCGGGCCAGGCTGG - Intergenic
1149742208 17:59057401-59057423 GGGGTTCATGTTGGCCAGGCTGG + Intronic
1151824457 17:76516177-76516199 GCACTTCAGGAGGGCAAGGCGGG - Intergenic
1152693807 17:81734024-81734046 GGGGTTCTGCCCGGCAGGGCTGG + Intergenic
1153903262 18:9637677-9637699 TGGGTTCAGGAGGCCAAGGCAGG + Intergenic
1154047529 18:10920939-10920961 GCTGTTCAGGAGGCCAAGGCAGG + Intronic
1155354257 18:24936344-24936366 GGGGGGCAGGGGTGCAAGGCAGG - Intergenic
1157876842 18:51281689-51281711 GTGGTTCAGTCTGGAAAGGCAGG + Intergenic
1158628057 18:59088931-59088953 GAGGATCAGGCTGGAAAGGCTGG - Intergenic
1160716573 19:579432-579454 GGGGGTCAGGCAGGCAGCGCGGG + Intronic
1161301547 19:3545184-3545206 CGGGTGCAGGCGGGCCATGCTGG - Intronic
1161524942 19:4748381-4748403 GGGGCTCAGGTGGGCAACCCAGG - Intergenic
1162552244 19:11364362-11364384 GGGGATCAGGTGGCCACGGCGGG - Exonic
1162808019 19:13148992-13149014 GGGGCTCAGGTGGGCAGGGTGGG + Intronic
1163014793 19:14447969-14447991 GCGCTTCAGGAGGCCAAGGCAGG - Intronic
1163034042 19:14561432-14561454 GGGGTGCAGAGGGGCAGGGCTGG - Intronic
1163124530 19:15237880-15237902 GGGCTGGAGGCGGGCGAGGCCGG - Exonic
1163747273 19:19055920-19055942 GGCGTGCAGGTGGGCAGGGCAGG + Exonic
1164781778 19:30898468-30898490 GCGCTTCAGGAGGCCAAGGCAGG - Intergenic
1164908411 19:31986001-31986023 GTGATTCAGGAGGCCAAGGCAGG + Intergenic
1165091146 19:33389005-33389027 GGAGTGCAGCCGGGCAGGGCAGG - Intronic
1165154966 19:33781420-33781442 GGGCTTTGGGTGGGCAAGGCTGG - Intergenic
1165871140 19:38974271-38974293 GGGGTTCATGTTGGCCAGGCTGG + Intronic
1167053722 19:47095664-47095686 TGGGTTCAGGAGGGGGAGGCTGG + Intronic
1167147906 19:47694011-47694033 GGGCTTCTGGCGGGGATGGCTGG + Intronic
1167168625 19:47816501-47816523 GGGGTTTGGGAGGCCAAGGCAGG - Intronic
1167232099 19:48291241-48291263 GGGTTTCAGGCGGCCAAGAAGGG - Intergenic
1167252374 19:48406749-48406771 GGAGGTCATGCGGGCATGGCGGG + Intronic
1167330829 19:48854950-48854972 GGACTTCAGGAGGCCAAGGCAGG - Intronic
1167592962 19:50414362-50414384 GCGGCTCAGGAGGCCAAGGCGGG - Intronic
1202694244 1_KI270712v1_random:112797-112819 GTGGTGCGGGCGGGGAAGGCCGG - Intergenic
925414086 2:3657312-3657334 GGAGTTCAGGAGGAGAAGGCCGG + Intergenic
927041275 2:19232913-19232935 GCTATTCAGGAGGGCAAGGCAGG - Intergenic
927620247 2:24648515-24648537 GCGCTTCAGGAGGCCAAGGCGGG - Intronic
927770760 2:25859059-25859081 GCGCTTCAGGAGGCCAAGGCAGG - Intronic
929518164 2:42623385-42623407 GGAGTCCAGGAGGGGAAGGCTGG - Intronic
929779243 2:44947080-44947102 GGGGTTTAGGAGGGCCAGGCTGG + Intergenic
931634197 2:64327162-64327184 TGGGACCAGGCGGGCAAGGCAGG + Intergenic
931932946 2:67161214-67161236 GGGGGTGAGGCTGGCGAGGCAGG + Intergenic
932258081 2:70303840-70303862 GTGGTCCAGGCTGGCAAGGAGGG + Intergenic
932262186 2:70336214-70336236 GCAGTTCAGGAGGCCAAGGCAGG - Intergenic
932345797 2:70994554-70994576 GGGGTTGGGGCGGCGAAGGCCGG + Intronic
932411249 2:71549304-71549326 GGGGTTAGGGTGGGCATGGCTGG - Intronic
932725812 2:74178841-74178863 GTGGGGTAGGCGGGCAAGGCGGG - Exonic
933745598 2:85568761-85568783 GCAGTTCAGGAGGCCAAGGCAGG + Intronic
934568516 2:95353688-95353710 TGGGTGCAGGCGGGCGAGCCTGG + Intronic
934666195 2:96172735-96172757 GGGGATAAGGGGGGCAAGGAGGG + Intergenic
935394828 2:102596443-102596465 GGGGTTCATGTTGGCCAGGCTGG + Intergenic
936454003 2:112656895-112656917 GGTGTTCAAGTGGGCTAGGCTGG + Intronic
946241179 2:218357025-218357047 AGGGGTCAGGGAGGCAAGGCAGG - Intronic
946353869 2:219172754-219172776 GGGGTGGAGGCAGGCATGGCAGG + Exonic
946395424 2:219441824-219441846 GGGGTGCAGGCTGGCGAGGGAGG + Intronic
946947631 2:224837963-224837985 GGGGCTGAGGAGGGCAAGGAAGG - Intronic
947622667 2:231600872-231600894 GGGGTGGAGGCCGGCTAGGCTGG - Intergenic
948507750 2:238441379-238441401 GCGCTTCAGGAGGCCAAGGCAGG - Intronic
948663832 2:239522539-239522561 CGGGCTCAGACGGGGAAGGCAGG - Intergenic
948900413 2:240953983-240954005 GGGGTACAGGAGGGAGAGGCAGG + Intronic
949012999 2:241692546-241692568 GGGCTTCAGGAGGCCGAGGCAGG - Intergenic
1170801459 20:19593926-19593948 GGGGTTCAGGAGTGAATGGCCGG - Intronic
1170840638 20:19922321-19922343 GTGGTTCAGGCTGGCACAGCTGG - Intronic
1171239057 20:23550683-23550705 GGAGTCCAGGCTGGGAAGGCTGG - Intergenic
1172295982 20:33811502-33811524 GGGGGTAAGGCCGGCAAGGGCGG + Exonic
1173162794 20:40664535-40664557 GGGGGGGAGGCGGGCAGGGCAGG + Intergenic
1174264076 20:49318773-49318795 GGGGGTCGCGCGGGCAAGGAGGG + Intergenic
1174622458 20:51886315-51886337 GCAATTCAGGCGGCCAAGGCAGG - Intergenic
1175399659 20:58693119-58693141 GGGGGTGCGGCGGGCGAGGCGGG - Intronic
1175572732 20:60036552-60036574 GGGCTTCAGGCAGAAAAGGCAGG - Intergenic
1178339461 21:31773753-31773775 GGGCTTCAGGAGGCTAAGGCAGG + Intergenic
1178556879 21:33599879-33599901 GGGATTTAGGAGGCCAAGGCAGG - Intronic
1181652841 22:24270575-24270597 GGGCTGGAGCCGGGCAAGGCGGG - Intergenic
1181681157 22:24496633-24496655 GGGCCTCAGGTGGGCGAGGCTGG + Intronic
1182667147 22:31968175-31968197 GGGGTAGAGGCGGGAGAGGCGGG + Intergenic
1183074797 22:35420012-35420034 GGTGAGCAGGCGGGCAGGGCTGG + Exonic
1183358821 22:37372992-37373014 AGGGTCCAGGCGGCCAGGGCGGG - Exonic
1184278028 22:43421403-43421425 GGGACTCAGCCGGGAAAGGCAGG - Intronic
950628502 3:14265968-14265990 GGGACTCAGGAGGCCAAGGCAGG + Intergenic
955060566 3:55488760-55488782 GGGGTCCAGGCGGGGAAGTTGGG - Intronic
958536794 3:95414433-95414455 GGACTTCAGGAGGCCAAGGCAGG + Intergenic
958564956 3:95797626-95797648 GGGGTCCTTGTGGGCAAGGCAGG + Intergenic
958939981 3:100300693-100300715 GGGGTTCATGTTGGCCAGGCTGG + Intronic
959085009 3:101842782-101842804 GGGTTTTAAGTGGGCAAGGCTGG + Intronic
959717550 3:109449784-109449806 GAGGCCAAGGCGGGCAAGGCGGG - Intergenic
959884414 3:111482208-111482230 GGGGTTGGGGGGGGCAAGACAGG + Intronic
960077518 3:113504486-113504508 GAGGTTCAGGAGGCCGAGGCAGG + Intronic
961660086 3:128463837-128463859 GGGGTTCAGGCAGGCTGGGGTGG + Exonic
961831222 3:129623890-129623912 GGGGGTGAGGAAGGCAAGGCTGG - Intergenic
962573358 3:136733859-136733881 GCGCTTCAGGAGGCCAAGGCGGG + Intronic
963721012 3:148862164-148862186 GGCTCTCAGGTGGGCAAGGCTGG - Intergenic
965674215 3:171177838-171177860 TGGGTTCAGGCAGGAAAGGAAGG - Intronic
968426207 4:525065-525087 CGGGGTCAGCCAGGCAAGGCAGG + Intronic
968466173 4:752542-752564 GGGGACCGGGCGGGCAAGGGTGG + Intronic
968512197 4:1000715-1000737 GGGGTGCAGGCGGGCTGGGAGGG - Intronic
969636755 4:8373922-8373944 GGGGTTCAGGGAGGCTGGGCGGG + Intronic
969723126 4:8904263-8904285 GGTGTTCAGGTGGGACAGGCAGG + Intergenic
973755643 4:54070763-54070785 GTGGTGCAGGCAGGCTAGGCTGG - Intronic
975694840 4:77001890-77001912 GTGCTTCAGGAGGCCAAGGCAGG + Intronic
975832078 4:78379908-78379930 GAGGTTCAGCTGGACAAGGCTGG + Exonic
978414727 4:108463486-108463508 GGGGGTCTGGTGGGCCAGGCTGG - Intergenic
983550124 4:169009515-169009537 GGAGTTCAGGCAGGAAAGGTGGG - Intronic
986301613 5:6482354-6482376 GGGGTGGAGGTGGGCGAGGCAGG - Intronic
987353862 5:17045183-17045205 GCACTTCAGGAGGGCAAGGCAGG + Intergenic
991189503 5:63852970-63852992 AGGATTGAGGAGGGCAAGGCAGG + Intergenic
994202678 5:96995766-96995788 GTGCTTTAGGAGGGCAAGGCAGG - Intronic
995224718 5:109689827-109689849 GGGGCTCAGTCGGGGTAGGCGGG + Exonic
995735633 5:115296787-115296809 GGGATTCAGGCGGGGAGGGGCGG + Exonic
997522307 5:134530783-134530805 GAGGTTAAGACGGGGAAGGCAGG + Intronic
998018955 5:138753723-138753745 GGGGCCCGGGCGGGCACGGCCGG + Intronic
999149795 5:149419297-149419319 GTGCTTCAGGAGGACAAGGCAGG + Intergenic
1001313999 5:170629949-170629971 GGGGCTGAGGCGGGCAAGGCAGG + Intronic
1002000413 5:176193741-176193763 GGGGTTCAGGGTGGCGGGGCTGG - Intergenic
1002172262 5:177381958-177381980 CGGGTTAAGGCTGGCAAAGCAGG + Intronic
1002253923 5:177945240-177945262 GGGGTTCAGGGTGGCGGGGCTGG + Intergenic
1002804195 6:556494-556516 GGGGTTCTGGAGTGCAAGCCGGG - Exonic
1003873607 6:10419373-10419395 GGGGTTGAGGTGGGCAGGGGTGG - Intronic
1004299287 6:14442542-14442564 GGGCATCAGGAGGGCAAGCCAGG + Intergenic
1006173861 6:32110148-32110170 GGGGTTGGGGCGGACAAGGAAGG + Intronic
1006196074 6:32243442-32243464 GGGGCTCAGGTGGGCATGGGGGG + Intergenic
1007400485 6:41599878-41599900 GGGGGAGAGGCGGGCAAGGAAGG - Exonic
1007733942 6:43968701-43968723 GGTGGGCAGGGGGGCAAGGCAGG + Intergenic
1010198438 6:73262951-73262973 GGGGGTCAGGTAGCCAAGGCTGG + Exonic
1011417036 6:87132778-87132800 GTGCTTCAGGAGGCCAAGGCAGG - Intergenic
1017239024 6:152147043-152147065 TGGGTGCAGGTGGGCAAGGGAGG - Intronic
1017826700 6:158086946-158086968 GGGGTTGAGGTGGCCGAGGCCGG - Exonic
1018726273 6:166615562-166615584 GTGTTTCAAGCGGGAAAGGCCGG - Intronic
1019153531 6:170024108-170024130 GGGGTTCAGCCGGGCTGGGCAGG - Intergenic
1019303810 7:322806-322828 TGGGGCCAGGAGGGCAAGGCGGG + Intergenic
1019395832 7:817049-817071 GGGGTCCAGGCGGGCAGCCCGGG - Intronic
1019948194 7:4347085-4347107 GGGGGGCAGGCGGGCAGGGCAGG + Intergenic
1021647129 7:22799556-22799578 GCGCTTTAGGAGGGCAAGGCGGG - Intergenic
1022113557 7:27245311-27245333 GGGGTCCAGGCTGGGGAGGCGGG + Intronic
1022445133 7:30464219-30464241 GCAGTTCAGGCAGGCATGGCCGG - Intronic
1022468815 7:30669292-30669314 GGGGCTCAGGCGGTCAGGACTGG - Intronic
1023992078 7:45134403-45134425 AGGGGTCAGGGTGGCAAGGCAGG + Intergenic
1025194857 7:56924826-56924848 GGGGTTCAGGCTGCCAAGGAAGG + Intergenic
1025250256 7:57347082-57347104 ACGGTTCAGGTGGGCAAGGACGG + Intergenic
1025677095 7:63652117-63652139 GGGGTTCAGGCTGCCAAGGAAGG - Intergenic
1026440024 7:70436248-70436270 GGGGTACGGGTGGGCAAGGGAGG + Intronic
1026847578 7:73706403-73706425 GGGGCTCTCCCGGGCAAGGCAGG - Intronic
1026972693 7:74477757-74477779 CCGGCTCAGGCGGGCAGGGCTGG + Intronic
1027024542 7:74841413-74841435 GGGCTTCGGGAGGCCAAGGCAGG - Intronic
1027063223 7:75102709-75102731 GGGCTTCGGGAGGCCAAGGCAGG + Intronic
1027201266 7:76065249-76065271 GGTGTTCAGGCGGGGTAGGGAGG - Intronic
1029381939 7:100220480-100220502 GGGGTCCAGGAGGGCAGGGAGGG + Intronic
1029402103 7:100352930-100352952 GGGGTCCAGGAGGGCAGGGAGGG + Intronic
1029473447 7:100768729-100768751 GGGGGTCAGGGGAGCCAGGCAGG + Intronic
1029672847 7:102045928-102045950 GGGGTTCAGGTTGCCAAGGAAGG + Intronic
1032128312 7:129210571-129210593 GAGGGTGAGGCGGGCAGGGCAGG - Intronic
1034272939 7:149812129-149812151 AGGGTCCAGGCGGGCAGGGCAGG - Intergenic
1036285779 8:7443197-7443219 GGGGTTTAGGCAGTCAATGCGGG + Intronic
1036335694 8:7868332-7868354 GGGGTTTAGGCAGTCAATGCGGG - Intronic
1036654684 8:10670630-10670652 GAGCTTCAGGAGGCCAAGGCAGG + Intronic
1036768582 8:11564109-11564131 GGGGCGCAGGCGGGCGCGGCCGG - Exonic
1037138213 8:15489193-15489215 TTGGTTCAGTCGGGAAAGGCAGG + Intronic
1037543045 8:19890286-19890308 GTGCTTCAGGAGGCCAAGGCAGG - Intergenic
1037695813 8:21223074-21223096 GCAGTTCAGGAGGCCAAGGCAGG + Intergenic
1039062546 8:33583244-33583266 TGGGTTCAGTCTGGAAAGGCAGG + Intergenic
1039157331 8:34575912-34575934 GGGTTTAAGCCGGGCAGGGCAGG + Intergenic
1039897311 8:41725489-41725511 TGTGTCCAGGCGGGCAGGGCGGG - Intronic
1039995838 8:42532346-42532368 GGGGTGGAGGTGGGGAAGGCAGG - Intronic
1042653828 8:71072920-71072942 GGGGTTTGGGAGGCCAAGGCAGG + Intergenic
1046467707 8:114628047-114628069 TGGGTTCAGGGGGCCAACGCTGG + Intergenic
1047967448 8:130056791-130056813 GGGGCTCAGGCTGCCAAGGAAGG + Intronic
1048056783 8:130874623-130874645 GGGCTTCAGAAGTGCAAGGCTGG + Intronic
1049238590 8:141525233-141525255 GAGGGTCAGGACGGCAAGGCTGG + Intergenic
1049364110 8:142228358-142228380 GGGCTGCAGCCGGGCAGGGCTGG - Intronic
1049413935 8:142486770-142486792 GCAGTTCAGGAGGCCAAGGCAGG + Intronic
1049462606 8:142737073-142737095 AGGGATCAGGCTGGCAGGGCAGG + Intergenic
1050247541 9:3706813-3706835 ATGGTTCAGGCAGGCAAGGTTGG - Intergenic
1054855263 9:69892666-69892688 GGGGTTGTGGCGGGCCAGGGTGG - Intronic
1056949872 9:91033513-91033535 GTGGTTCAGGTGGGCCAGCCTGG - Intergenic
1057907679 9:98995007-98995029 TGGGATGAGGCGGGCAGGGCAGG - Intronic
1058735756 9:107892551-107892573 TGGGTTCAGGCGAGCACGTCTGG - Intergenic
1061450899 9:130666530-130666552 GGGGTCCCGGCGGGGAAGGAAGG + Intronic
1061876551 9:133546935-133546957 GGGGTTCTGGAGGGCAGGGCTGG + Intronic
1061942930 9:133892692-133892714 GGAGCTCAGGAGGGCAGGGCAGG + Intronic
1062162427 9:135087710-135087732 GGGACGCAGCCGGGCAAGGCAGG + Intronic
1062216677 9:135393118-135393140 GGGCTTGAGGCAGGCAAGGTGGG - Intergenic
1062349990 9:136133807-136133829 GGGGCTCAGGTGAGCCAGGCTGG + Intergenic
1062399503 9:136366246-136366268 GGGCTTCTAGCGGGCAGGGCAGG - Intronic
1185782864 X:2864304-2864326 TTGGTTCAGTCCGGCAAGGCGGG + Intronic
1190388840 X:49911784-49911806 GAGGTTGAGGCCGGCAAGGTGGG + Intergenic
1194590497 X:95794660-95794682 GGGGTTTGGGAGGCCAAGGCAGG + Intergenic
1199709146 X:150456156-150456178 TGGGTTCATTCGGGGAAGGCTGG + Intronic
1200099959 X:153685434-153685456 GAAGTTCAGGCTGGTAAGGCTGG - Intronic
1200126739 X:153818863-153818885 GGGGGACATGCGGGCAAGGGAGG + Intronic
1201579222 Y:15493595-15493617 GGGATTCAGGGGGGAAAGGTGGG - Intergenic
1201891117 Y:18945130-18945152 GGGCTTAAGGTGGGCAAGGTGGG + Intergenic