ID: 1077905648

View in Genome Browser
Species Human (GRCh38)
Location 11:6530753-6530775
Sequence CAGGCGGGCAAGGCAGGAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 278}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077905640_1077905648 -1 Left 1077905640 11:6530731-6530753 CCCTCCTCTTGTACAGGGGGTTC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1077905648 11:6530753-6530775 CAGGCGGGCAAGGCAGGAACCGG 0: 1
1: 0
2: 1
3: 25
4: 278
1077905634_1077905648 18 Left 1077905634 11:6530712-6530734 CCAGTGGGCCACTAAAACTCCCT 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1077905648 11:6530753-6530775 CAGGCGGGCAAGGCAGGAACCGG 0: 1
1: 0
2: 1
3: 25
4: 278
1077905641_1077905648 -2 Left 1077905641 11:6530732-6530754 CCTCCTCTTGTACAGGGGGTTCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1077905648 11:6530753-6530775 CAGGCGGGCAAGGCAGGAACCGG 0: 1
1: 0
2: 1
3: 25
4: 278
1077905635_1077905648 10 Left 1077905635 11:6530720-6530742 CCACTAAAACTCCCTCCTCTTGT 0: 1
1: 0
2: 2
3: 19
4: 223
Right 1077905648 11:6530753-6530775 CAGGCGGGCAAGGCAGGAACCGG 0: 1
1: 0
2: 1
3: 25
4: 278
1077905643_1077905648 -5 Left 1077905643 11:6530735-6530757 CCTCTTGTACAGGGGGTTCAGGC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1077905648 11:6530753-6530775 CAGGCGGGCAAGGCAGGAACCGG 0: 1
1: 0
2: 1
3: 25
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077905648 Original CRISPR CAGGCGGGCAAGGCAGGAAC CGG Intronic
900242491 1:1623714-1623736 CAGGCGGGACGGGCAGGACCCGG + Intronic
900579536 1:3402239-3402261 CAGGCAGGGGAGGCAGGGACGGG + Intronic
900985210 1:6069191-6069213 CAGGCGAGCAGGGCACTAACAGG + Intronic
901145412 1:7061597-7061619 CAGACAGGCCAGGGAGGAACAGG + Intronic
901386158 1:8910661-8910683 CAGACGTGCAAGGAAGGAAATGG + Intergenic
901659279 1:10788622-10788644 CAGGTGGCCAAGGATGGAACAGG + Intronic
901684670 1:10937345-10937367 AAGGCTGGCAAGGAAGGAAAGGG - Intergenic
901776707 1:11565228-11565250 CAGGTGGGGAAAGCTGGAACTGG - Intergenic
902439815 1:16421933-16421955 CAGGCGTGGATGGCAGGAAGGGG + Exonic
902609180 1:17587368-17587390 TAGGTGGGCATGGCTGGAACTGG - Intronic
902933885 1:19750573-19750595 CAGGCAGGCAAGGAGGGAAGAGG - Intronic
903022094 1:20401635-20401657 CAGCTGGGCAAGGCGGGAGCAGG + Intergenic
903626761 1:24736223-24736245 CAGGCGAGCAGGGCAGAAAGGGG + Intergenic
903809558 1:26027876-26027898 CAGGCTGACAAGGCAGGGAGGGG + Intronic
903986914 1:27235041-27235063 CAGGCCGGCAGGGCTGGAGCCGG - Intronic
904377362 1:30090262-30090284 GAAGCGGGGAAGGCAGGAGCAGG + Intergenic
904495735 1:30885684-30885706 CAGGCTGGCTTGGCAGGACCTGG + Intronic
906116632 1:43361257-43361279 CATGTGGGAGAGGCAGGAACAGG - Intronic
906120366 1:43386088-43386110 CAGGCAGGCCAGCCAGGAGCTGG - Exonic
906242465 1:44250480-44250502 CAGGAGGGCCAGGCTGGACCAGG + Intronic
911003096 1:93188464-93188486 CAGGCAGGCAAGGAAGTAACTGG - Intronic
911471391 1:98323238-98323260 TAGTGGGGGAAGGCAGGAACAGG + Intergenic
912512805 1:110200038-110200060 CTGGTGGGCAGGGCAGAAACAGG + Exonic
913531590 1:119737677-119737699 CAGGCTGTCAAGGCAGGGTCTGG - Intronic
914332331 1:146683742-146683764 CAGGCTGGAAAGAAAGGAACAGG - Intergenic
914950919 1:152112784-152112806 CAGGCAGAAGAGGCAGGAACAGG - Exonic
915093274 1:153441422-153441444 GAGGCAGGCAGAGCAGGAACAGG - Intergenic
916574519 1:166055414-166055436 TGGGCAGGGAAGGCAGGAACAGG + Intergenic
919726490 1:200888003-200888025 GAGGCGGGGAAGGTAGGAAGAGG + Intergenic
920201405 1:204261916-204261938 CAGGCATGCAAAGCAGGCACTGG + Intronic
922700486 1:227756827-227756849 CAGTGGGGCATGGCAGGACCAGG - Intronic
922717359 1:227884583-227884605 CACACGGGCAGGACAGGAACAGG - Intergenic
922780002 1:228244493-228244515 CAGGCGGGCAAAGCAGATGCTGG + Exonic
922781955 1:228259698-228259720 CAGGCAGGCCAGGCAGACACCGG + Exonic
922783056 1:228268727-228268749 CAGGCGGGCCAGGCAGAGGCCGG + Exonic
1062797813 10:357817-357839 CAGGCACGCAAGGTAGGAGCTGG - Exonic
1062828398 10:588298-588320 CAGGAGGGCAGGGAAGGACCAGG + Intronic
1063271078 10:4510370-4510392 CAGGGGGGGAAGGCAAGAAGGGG + Intergenic
1063666486 10:8063716-8063738 AAGTCGGGCAAGCCAAGAACAGG + Intronic
1064443177 10:15371292-15371314 GCGGCGGGCGAGGCAGGAAGGGG - Intergenic
1067042244 10:42961185-42961207 CAGTGAGGCATGGCAGGAACAGG - Intergenic
1069583396 10:69580062-69580084 CAGGTTGGGAAGGCAGGAAGGGG + Intergenic
1070167879 10:73911789-73911811 CTGGCTGGCAAGGGAGGAAGAGG + Exonic
1070758528 10:79008661-79008683 GAGGAGGGACAGGCAGGAACAGG + Intergenic
1071144210 10:82548601-82548623 CAGTCGGGCAAGGCAGGACCTGG + Intronic
1072735183 10:97874340-97874362 TAGGCGGGCATGGCATGGACTGG - Intronic
1072794240 10:98342223-98342245 CAGGCGGGGGAGGCAGGCACGGG - Intergenic
1073504754 10:103975398-103975420 TTGGCGGGGAAGGCAGCAACAGG - Intronic
1074867305 10:117552431-117552453 CAGGCGGGCCAGGCAGAAAGGGG + Intergenic
1075591024 10:123691815-123691837 CAGCAGGGCCAGGCAGGACCTGG + Exonic
1075670607 10:124261708-124261730 CAGGTGGCAAAGGCAGGACCAGG - Intergenic
1077351060 11:2093377-2093399 CAGCCGGTAAAGGCAGGAGCTGG - Intergenic
1077905648 11:6530753-6530775 CAGGCGGGCAAGGCAGGAACCGG + Intronic
1078741204 11:14067741-14067763 AAGGCTGGGAAAGCAGGAACAGG + Intronic
1079277553 11:19056052-19056074 CAGGCCTGCAAGGTAGGCACAGG + Exonic
1080172067 11:29316354-29316376 AAGGCTGGCAAGACAGGAACTGG - Intergenic
1080698259 11:34621779-34621801 CAGGCAGCCAAGGCAGGCAGAGG + Intronic
1080844433 11:36014542-36014564 CAGGCGGGAAAGGAGGGAGCAGG - Intronic
1081733644 11:45388813-45388835 GAGGTGGGCAAGGCAGGAGCTGG + Intergenic
1083280165 11:61622093-61622115 CACACGGGCAAGGCAGGAAAAGG - Intergenic
1085022969 11:73220578-73220600 GAGCCTGGCAGGGCAGGAACTGG - Intronic
1088695761 11:112364551-112364573 CAGGTGGCCACGTCAGGAACTGG - Intergenic
1088735206 11:112723068-112723090 CAGGCAGGCAAGGCAGAGAGAGG + Intergenic
1089605782 11:119640458-119640480 CAGGAGGGAAAGGCAGGAGCTGG + Intronic
1090936016 11:131343207-131343229 CAGGGAGGCAAGGCAAGAATGGG - Intergenic
1092163340 12:6328020-6328042 AAAGAGGGCAAAGCAGGAACAGG + Intronic
1096574562 12:52544610-52544632 GAGGCGGGGAGGGCAGGAGCCGG - Exonic
1098290512 12:68953055-68953077 CAGGCCAGGAAGGCAGGTACTGG + Intronic
1099786890 12:87276071-87276093 CTTGGGGGCAAGGCAGGAAGGGG + Intergenic
1101148949 12:101867124-101867146 CAAGCAAGCAAGGCAGGAATTGG - Intergenic
1101466743 12:104957801-104957823 CGGGCGCCCAAGGCAGGGACAGG - Intronic
1101906617 12:108831516-108831538 CTGGAGGGCCAGGCAGGCACAGG + Intronic
1102036072 12:109771242-109771264 GAGGAGGCGAAGGCAGGAACGGG - Intergenic
1102201657 12:111061571-111061593 TAGGCGGGCAAAGCAGGACGAGG - Intronic
1102484485 12:113246725-113246747 CCAGCTGGAAAGGCAGGAACTGG - Intronic
1103991839 12:124804622-124804644 CAGACGGGCCAGACAGGACCAGG + Intronic
1104200078 12:126580122-126580144 CAGGGGGTGAAGGCAGGAAAGGG + Intergenic
1104878966 12:132055980-132056002 CAGGTGGGCATGGGAGGAGCGGG + Intronic
1104921847 12:132294677-132294699 CAGGAAGGCAGGGCAGGAGCAGG + Intronic
1105467667 13:20661277-20661299 CAGGAAGGAAAGGCAGGAACAGG + Intronic
1105795318 13:23846129-23846151 CAGGAGGTCAAGGCAGGAGGAGG - Intronic
1106078344 13:26479845-26479867 CAGGCCAGCAAGGCAGGTACCGG + Intergenic
1107721502 13:43253259-43253281 AAGGCGGGAAAGACTGGAACAGG - Intronic
1110190964 13:72728069-72728091 CGGGCAGGCAAGTCAGGAGCTGG - Intronic
1110422994 13:75334785-75334807 CATGTCGGCCAGGCAGGAACAGG + Intronic
1113443964 13:110351413-110351435 CACGCCGGCAAGGGAGGAGCAGG - Intronic
1113961252 13:114127486-114127508 CAGGCAGGGAAGGAAGGAAGGGG - Intronic
1115680829 14:35736047-35736069 CAGGTGGGCAGGGCAGAAGCAGG + Intronic
1118910789 14:70060361-70060383 CAGGGGAGGAAGGCAGGAAGGGG + Intronic
1121441304 14:93951272-93951294 CAGCAGGGCCTGGCAGGAACTGG + Intronic
1121944382 14:98105071-98105093 TAGTGGGGAAAGGCAGGAACTGG - Intergenic
1122037006 14:98956283-98956305 CAGGCTGGCAGGGCAGGTGCTGG + Intergenic
1122050734 14:99057954-99057976 CAGGTGGGCGAGGCAGAAAGAGG + Intergenic
1122205550 14:100146275-100146297 CAGGAGTGCATGGCAGGACCTGG + Exonic
1122719101 14:103712289-103712311 CAGGCAGGCCTGACAGGAACTGG + Intronic
1122954819 14:105065703-105065725 CAGACAGGCAAGGCAGGACAGGG + Intergenic
1122993074 14:105248021-105248043 CGGGTGGGCAAGTCAGGATCTGG - Intronic
1123117584 14:105901628-105901650 CAGGTGCCCAAGGCAGGAAATGG - Intergenic
1123995627 15:25716169-25716191 CAGGCGGGCACCCCAGGCACAGG + Intronic
1125048298 15:35268849-35268871 AAGGCTGGCAAGGTAGGAAGAGG + Intronic
1125605416 15:40937379-40937401 CAGGCGTGTAAGGGAGGGACGGG - Intronic
1125605598 15:40938151-40938173 GAGGAGGGAATGGCAGGAACCGG + Exonic
1126579908 15:50233171-50233193 CAGGAGGTGAAGGCAGGCACAGG - Intronic
1128791696 15:70439066-70439088 CAGGCGGGCGAGGCAGGCAGAGG + Intergenic
1129853947 15:78811210-78811232 CCGCCGGGCATGGCAGGAACCGG + Exonic
1130381184 15:83373743-83373765 CTGGCAGGGAAGCCAGGAACGGG - Intergenic
1131546725 15:93321972-93321994 CAGGCATGCATAGCAGGAACTGG + Intergenic
1132552984 16:560841-560863 CAGGCGGGGAGGGCAGGGGCCGG + Intronic
1132713660 16:1280053-1280075 CAGGCGGGGTGGGCAGGAACAGG + Intergenic
1132725589 16:1336959-1336981 GAGGCCGGCAAGGCTGGGACAGG + Intronic
1132847745 16:2008337-2008359 CTGGCTGGCAAGGCAGGCCCTGG + Intronic
1132871689 16:2118257-2118279 CAGGCAGGCAAAGGAGGCACTGG + Exonic
1132977143 16:2716499-2716521 CAGAGGGCCAAGGCAGCAACAGG - Exonic
1136224029 16:28846654-28846676 CAGGCGGGCTAGGCCGGACCCGG + Intronic
1136294732 16:29295096-29295118 CAGGCAGGGCAGGCAGGAGCTGG + Intergenic
1136997680 16:35201947-35201969 CAGGTGGGCAGGGCCGGAAGAGG - Intergenic
1137262400 16:46842562-46842584 CAGGGGTGCATGGCAGGCACTGG + Intergenic
1138146844 16:54620287-54620309 CAGGGGGGCAAGAGAGGAAGTGG + Intergenic
1138588125 16:57984897-57984919 GCGGCGGGCCAGGCAGAAACAGG + Intronic
1140001222 16:71027177-71027199 CAGGCTGGAAAGAAAGGAACAGG + Intronic
1140232340 16:73127603-73127625 CTGGCAGGCAAGAAAGGAACAGG + Intronic
1141572167 16:84940830-84940852 GAGGCTGGCAAGGCGGGCACGGG - Intergenic
1142177224 16:88650833-88650855 CAGGCGGGCCAGGCCGGGCCGGG - Intronic
1142192215 16:88723244-88723266 GGAGCAGGCAAGGCAGGAACAGG - Exonic
1142206172 16:88784278-88784300 CAGTAGGGCAAGGGAGGACCAGG + Intronic
1142556534 17:782120-782142 CTGGCGCGCGAGGCTGGAACCGG - Intronic
1143016779 17:3895030-3895052 CAGGCTGGGAAGTCAGGAAAGGG + Intergenic
1143688320 17:8537966-8537988 CAGTCTGGCAAGGCAGGGGCTGG + Intronic
1144480183 17:15622417-15622439 TAGGAGGGCAAGGAATGAACTGG + Intronic
1144918123 17:18741321-18741343 TAGGAGGGCAAGGAATGAACTGG - Intergenic
1146057733 17:29589534-29589556 CAGGCGGGCACGGCGGGTTCCGG - Exonic
1146703276 17:34980722-34980744 CAGGCGGGCGGGGGAGGAGCCGG - Intronic
1147603920 17:41763322-41763344 CTGGAGGGCAAGGAAGGGACGGG + Intronic
1147707504 17:42437083-42437105 CGGGAGGCCAAGGCAGGAAAAGG + Intergenic
1147979904 17:44268034-44268056 CAGGTGGGCAGGGCAGGGAGGGG - Exonic
1148070044 17:44903444-44903466 CAGGCTGGCAGGGCAGGGCCTGG + Exonic
1148087051 17:45000613-45000635 TGGGCAGGCAAGGCAGGGACAGG + Intergenic
1148757419 17:49980877-49980899 CTGGCAGGCAAGGCAGGCAGTGG - Intergenic
1151759017 17:76090242-76090264 CAGCTGGGCCAGGCAGGAGCAGG + Intronic
1152038823 17:77890306-77890328 CCGGCGGGGAAGGCAGGACTTGG + Intergenic
1152168610 17:78727658-78727680 CAGCAGGGCAAGGCTGGAGCAGG + Intronic
1152472965 17:80500423-80500445 CAGGCTGGCAAGGAAGGAATTGG + Intergenic
1152648129 17:81479684-81479706 CAGGCGGAGAAGCCAGGGACAGG + Intergenic
1159993714 18:74941075-74941097 CAGCAGGGCAAGGCAAGGACGGG - Intronic
1161329521 19:3679605-3679627 CAGGCGGGCTGGGCTGGATCTGG + Intronic
1162135694 19:8554030-8554052 CAGGAGTTCCAGGCAGGAACAGG - Intronic
1162435337 19:10654642-10654664 GAGGCCGGCAAGGGAGGAACGGG - Intronic
1164588746 19:29494655-29494677 GAGGGGGGGAAGGAAGGAACGGG + Intergenic
1165213568 19:34254218-34254240 CCGACGGGCACTGCAGGAACGGG - Intergenic
1165407396 19:35639168-35639190 AAGGCGGGGAAGACAGGAACAGG - Intergenic
1166072347 19:40394636-40394658 CAGGCGGGCGAGGCGGCCACAGG - Exonic
1166680478 19:44763237-44763259 CAGGCGGGCCAGGCACACACAGG - Intergenic
1167153274 19:47722419-47722441 CTTGCGGGCAACGCAGGGACCGG - Intronic
1167254884 19:48421480-48421502 GAGGCTGGCATGGCAGGAGCTGG - Intronic
1167607171 19:50487642-50487664 GGAGCAGGCAAGGCAGGAACAGG + Exonic
925233166 2:2253719-2253741 CAGGAGGGCAAGTCGGAAACAGG + Intronic
925233174 2:2253750-2253772 CAGGAGGGCAAGTCGGAAACAGG + Intronic
925233182 2:2253781-2253803 CAGGAGGGCAAGTCGGAAACAGG + Intronic
925282556 2:2694967-2694989 CAGGCGGCCATGGCAGGATAAGG - Intergenic
925730788 2:6918130-6918152 CCGGCGGGGAAGGTCGGAACTGG + Intronic
925877747 2:8327407-8327429 CAGGAGGCCAAGGGAGGAAGTGG + Intergenic
926380829 2:12287616-12287638 CAGGCTGGCAAGGCAAGCACCGG + Intergenic
928572039 2:32619228-32619250 CAGGAGGCTGAGGCAGGAACTGG + Intergenic
929263712 2:39895094-39895116 CAGGAGGGAAAGTCAGGAAAAGG - Intergenic
929565181 2:42979511-42979533 CAGAGGGGCAATGCAGGAAGGGG + Intergenic
933648023 2:84828069-84828091 CAGGGGGAGAAGGGAGGAACTGG + Intronic
935131477 2:100264384-100264406 GAGGGAGGCAAGGGAGGAACGGG + Intergenic
935423477 2:102894892-102894914 CAGGCTGGAAGGGCAGGAACTGG + Intergenic
936029842 2:109062437-109062459 CAGGAGTGCAAGCCAGGGACTGG - Intergenic
936383735 2:112010844-112010866 GATGCGTGCAAGGCAGGAAGGGG - Intronic
937140476 2:119595908-119595930 CAGGGCTGCAAGGCTGGAACAGG + Intronic
937249402 2:120514065-120514087 CAGGGTGGCCAGGCAGGAAAAGG - Intergenic
937825487 2:126364467-126364489 GAGGTGGGCAAAGCAGGAAATGG - Intergenic
937837121 2:126482849-126482871 CTGGCGCCCAAGGCAGAAACAGG - Intergenic
938092190 2:128441208-128441230 TAGGCAGGCAGGGCAGGGACAGG - Intergenic
938501289 2:131832383-131832405 CTGTCGGGCGAGGCAGGAGCAGG + Intergenic
939845718 2:147244049-147244071 CAGGCTGGGGAGGGAGGAACGGG + Intergenic
939863457 2:147445853-147445875 GAGGCGGGCAGATCAGGAACAGG - Intergenic
940517151 2:154697471-154697493 CAGCGGGGGAAGGCAGGGACAGG + Intergenic
940807916 2:158208542-158208564 CAGGGTGGCACGACAGGAACAGG + Intronic
941785619 2:169495573-169495595 CAGGCTGGTAAGACAGAAACTGG - Intronic
946009752 2:216555081-216555103 CAGGTGGGCCAGAGAGGAACTGG + Intronic
948560232 2:238847293-238847315 CAGGCGGGCGCGGCGGGTACCGG + Intergenic
948694977 2:239728683-239728705 CAGGCAGGCAAGGAAGGAAGGGG - Intergenic
948707318 2:239803115-239803137 CAGGCGGGGAAGGATGGAAGGGG - Intergenic
948815937 2:240510328-240510350 GAGGCGGGAAGGGCAGGGACGGG - Intronic
948919086 2:241052953-241052975 GAGCTGGGCAAGGCAGGAATGGG + Intronic
949079967 2:242088790-242088812 CAGGCGCGCTAGGTAGGTACGGG + Intergenic
1169277876 20:4245749-4245771 CAGCTGGGCAAGGCTGGAGCAGG + Intronic
1170629675 20:18056566-18056588 CAGGCGGGCGCGGCAGGGAGGGG + Intronic
1172881619 20:38203501-38203523 CAGGTGCGCCAGGCAGGAGCAGG - Intergenic
1173245830 20:41336798-41336820 CAGGCAGGGAAAGCATGAACAGG + Intergenic
1175551956 20:59823025-59823047 CTGGAGGGCAAGGCAGGCCCTGG + Intronic
1175743005 20:61433960-61433982 CAGGAGGCCACGGCAGGAAATGG - Intronic
1175972283 20:62692689-62692711 GAGGCCGGGCAGGCAGGAACAGG + Intergenic
1176265603 20:64207752-64207774 CAGGCGGCCAAGCCAGGTCCTGG + Exonic
1180190831 21:46161775-46161797 CAGGCGGGCGGGGCAGGGATCGG - Intronic
1181045455 22:20212084-20212106 CAGGCTGGAAAGGCAGGTGCTGG - Intergenic
1181485952 22:23231923-23231945 CAGGCAGGCAAGACAGGGCCAGG - Intronic
1182026781 22:27125512-27125534 CAGATGGGCAAGGCAGGGAAGGG + Intergenic
1182066474 22:27434886-27434908 CAGGCGAGCAATGCACGTACAGG + Intergenic
1182159305 22:28105637-28105659 CTGGCGTTCAAGGCAGGAAATGG + Exonic
1182285555 22:29245001-29245023 TAAGAGGGCAAGGCAGGCACTGG - Intronic
1182478889 22:30593552-30593574 CATGAGGGCAACACAGGAACAGG + Intronic
1182810511 22:33112141-33112163 CAGGGGGTCAAGGCTGGAGCTGG + Intergenic
1183061339 22:35338117-35338139 CAGGGTGGGGAGGCAGGAACTGG - Intronic
1184250235 22:43255980-43256002 CAGGCTGGAGAGGCAGGCACAGG + Intronic
1184927242 22:47651469-47651491 CAGGAGGCCAGGGCAAGAACAGG + Intergenic
1184927396 22:47652810-47652832 CAGCCAGGCAAGGCAGGACGTGG + Intergenic
1184941548 22:47769794-47769816 AAGGAGGGCATGGCAGGAAGTGG - Intergenic
949660782 3:6275917-6275939 CAGGCGGCCGAGGCAGGAAGAGG + Intergenic
950501896 3:13369843-13369865 CAAGAGGGCAAGGCAGAAATGGG + Intronic
952967144 3:38628397-38628419 CAGGTGGGCAAGGGAGGCAGTGG - Intronic
953667894 3:44939162-44939184 CAGGAGGGCAAGGTAAGAAAAGG + Intronic
953793553 3:45966416-45966438 AAGGCGGCCAAGGCAGCAGCCGG - Exonic
954451119 3:50572219-50572241 CACCAGGGCAAGGCAGGATCAGG + Intronic
954765597 3:52913037-52913059 CAGGGTGGCAAGTCAGGATCTGG - Intronic
954840815 3:53509684-53509706 CAGCCAGGGAAGGCAGGAAGAGG + Intronic
955815821 3:62841609-62841631 CAGGAGGGTGAGGCAGGAAGAGG + Intronic
956837021 3:73103869-73103891 CAGGTTGGCAAGGCAGGCATGGG - Intergenic
957155405 3:76538002-76538024 CAATCGGTGAAGGCAGGAACTGG + Intronic
959773380 3:110126297-110126319 CAAGCAAACAAGGCAGGAACTGG - Intergenic
961568317 3:127779836-127779858 CAGGCTGGCGATGCAGGTACTGG - Intronic
961616783 3:128188839-128188861 CAGGTGGGCAAGGCTGGGAGGGG - Intronic
962390281 3:134965968-134965990 CAGGCAGGGAAGGCAGGAGATGG - Intronic
963534915 3:146514983-146515005 CAGGCAAACAAGGCAGGAACTGG - Intergenic
966767896 3:183479022-183479044 CTGGCAGGCAACACAGGAACTGG - Intergenic
968279479 3:197465275-197465297 CAGGCAGGCAGAGCGGGAACCGG + Intergenic
969475762 4:7421765-7421787 GAGGAGGCCAAAGCAGGAACAGG - Intronic
970249055 4:14094694-14094716 GAGGCGGGCCAGGCAGGATCAGG + Intergenic
972308335 4:37853952-37853974 CAGGGGTGGAAAGCAGGAACAGG - Intronic
972375119 4:38462700-38462722 CAGGAGAGCAGGGCAGGACCTGG - Intergenic
972637271 4:40895485-40895507 CAGGCAGGCCAGGCAAGACCTGG - Intronic
972789476 4:42357274-42357296 GAGGCGGGCAGGGAAGGAAAGGG + Intergenic
974783761 4:66590308-66590330 CATGAGGACAAGGCAGGGACAGG - Intergenic
977019423 4:91741137-91741159 CAAGTGAACAAGGCAGGAACTGG - Intergenic
978540478 4:109811220-109811242 CAGTTGGGCAGGGAAGGAACAGG + Intergenic
978627850 4:110707721-110707743 CAGGCTGGAAGGGAAGGAACAGG - Intergenic
980167100 4:129242188-129242210 CAGGAGGGCCAGGCAGAGACAGG + Intergenic
985558075 5:567937-567959 CAGGTGGGCTGGGCAGGCACTGG - Intergenic
994756036 5:103794399-103794421 CAGGAGGATAAGGCAGGAAAAGG - Intergenic
997657294 5:135564759-135564781 AAGGCAGGCCAGGCTGGAACAGG + Intergenic
998390967 5:141786878-141786900 CCGGGGGGCAAGGCAGGCACTGG - Intergenic
998614063 5:143720187-143720209 GAGGAGGGCAAGACTGGAACAGG + Intergenic
1001011799 5:168105416-168105438 CAGTCAGGGAAGGCAGGAAGGGG + Intronic
1001117861 5:168954720-168954742 CAGGCAGGTAAGGCAGGAGGGGG + Intronic
1001406757 5:171482184-171482206 CAGGAGGTCAAGGGAGGAGCAGG + Intergenic
1002196748 5:177505221-177505243 GAGCCGGGCAAAGCTGGAACTGG - Intronic
1002640987 5:180630522-180630544 GAGGCGGGCCAGGCTGGAGCAGG - Intronic
1002846283 6:948061-948083 CAGGTGAGAAAGGCAGGAATGGG + Intergenic
1004862546 6:19819773-19819795 CTGGGAGGCATGGCAGGAACTGG - Intergenic
1005232772 6:23723383-23723405 CAGGTGGGCTGGGCAGGACCTGG + Intergenic
1006359588 6:33579863-33579885 GAGGCAGGCATGGCAGGATCAGG + Intronic
1006987822 6:38188402-38188424 GAGGCGGGCAGAGCAGGGACTGG - Intronic
1007281559 6:40716038-40716060 CTAGAGGGAAAGGCAGGAACTGG + Intergenic
1013343845 6:109240519-109240541 CAGGAGAGCAAGGAAGAAACTGG - Intergenic
1016192621 6:141289051-141289073 GAGCCTGGCAATGCAGGAACTGG + Intergenic
1019303815 7:322812-322834 CAGGAGGGCAAGGCGGGGAGGGG + Intergenic
1019911434 7:4102666-4102688 CTGGTGGGCAGGGCAGGACCAGG - Intronic
1021541593 7:21765396-21765418 CATGGGGGCAAGGCAGAAACAGG - Intronic
1021843679 7:24743731-24743753 CAGGAGGGCAGGGAAGGCACAGG - Intronic
1022494109 7:30842625-30842647 CAGGAGAGCCAGACAGGAACAGG + Intronic
1023555805 7:41421754-41421776 CTTGAGGGAAAGGCAGGAACAGG + Intergenic
1023995780 7:45158084-45158106 CTGGCGGGCAAGGGAGGCACAGG + Intronic
1024377487 7:48656032-48656054 CAGGCTGGTAAGGCATGATCAGG + Intergenic
1025031646 7:55561600-55561622 CAGGAGGCCAAGGCAGGAGAGGG + Intronic
1026584865 7:71647882-71647904 CAGCCAGGCAGGGCAGGAAGCGG + Intronic
1029123980 7:98285028-98285050 CAAGCGGGGAAGGCAGGAGTGGG + Intronic
1029422415 7:100478173-100478195 CAGGAGGGCCTGGCGGGAACCGG + Exonic
1029688265 7:102163715-102163737 GAGGCGGGCTGGGCAGGAAGAGG + Intronic
1030309318 7:108053595-108053617 CAGGTGGGCTAGGAGGGAACAGG + Intronic
1033093082 7:138404644-138404666 CAGTGGGGAAAGGAAGGAACTGG + Intergenic
1034381017 7:150692365-150692387 CTGGTGGGCAAAACAGGAACTGG + Exonic
1034412211 7:150947570-150947592 CGGGCGGGCGAGGGAGGACCGGG - Intronic
1035349567 7:158236651-158236673 CTGGGGGGCCAGGCAGGGACAGG - Intronic
1036453954 8:8892510-8892532 CAGGCGGGAGAGGCAGGAGAGGG + Exonic
1036656552 8:10680900-10680922 CAGGCAGCCCAGGCAGGAGCGGG + Intronic
1037733184 8:21546509-21546531 CTGGAGAGCAAGGCAGGAGCTGG - Intergenic
1037962468 8:23108157-23108179 CAGGAAGGAAAGGAAGGAACAGG + Intronic
1040478992 8:47806380-47806402 GAGGCAGGCAGAGCAGGAACTGG - Intronic
1040561635 8:48527955-48527977 CAGTCAGGGAAGGAAGGAACAGG - Intergenic
1040816291 8:51511646-51511668 CAGGCAGGCAGGGCAGAAAAAGG + Intronic
1040862000 8:52008606-52008628 CTGGAGGGCAGGGCTGGAACAGG - Intergenic
1041313335 8:56538211-56538233 CAGGTGGGCAAGGGAGACACAGG - Intergenic
1043310991 8:78859381-78859403 CAGGCGGGCAGGCCATCAACAGG - Intergenic
1044064393 8:87681858-87681880 CAGGCAGACAAGGTAGGAAAAGG + Intergenic
1049218791 8:141419483-141419505 CAGTCGGGCAAGGTGGGGACTGG + Intronic
1049278120 8:141730100-141730122 GGGGTGGGCAAGGCAGGAGCTGG - Intergenic
1050116532 9:2269232-2269254 CAGGTGTGCAAAGCAGGAGCTGG + Intergenic
1053234143 9:36437151-36437173 CAGCTGAGCAAGGCAGGACCAGG + Intronic
1057386444 9:94609569-94609591 CCGGGGGGCAAGGGTGGAACTGG - Intronic
1058755632 9:108080518-108080540 GAGGCAGGCCAGGCAGGAAGAGG - Intergenic
1059376428 9:113885169-113885191 CAGTGGGGCAAGGCAGGCCCTGG + Intronic
1060218197 9:121751013-121751035 CAGGTGGGGAAGGAAGGACCGGG - Intronic
1060342395 9:122789022-122789044 CAGGCAGGCAGGTCAGGAAGAGG - Exonic
1060583346 9:124770978-124771000 CGCCCGGGCCAGGCAGGAACCGG - Intronic
1062373164 9:136250692-136250714 CAGGTGGGCTGGGCAGGAGCTGG + Intergenic
1062444663 9:136588551-136588573 CAGAGGGGCAGGGCAGGAAGGGG + Intergenic
1187195088 X:17075988-17076010 AAGACAGGCAAGGCAGCAACAGG - Intronic
1187461810 X:19493719-19493741 CAGGCAGGCAGGGCAAGCACTGG + Intronic
1187791604 X:22956245-22956267 CAGGCTGGGAAGCCAGAAACAGG - Intergenic
1189278273 X:39803175-39803197 AAAGCCGGCAAGGCATGAACTGG + Intergenic
1191085552 X:56563835-56563857 CAGGCGGGCAGGGAAGGCGCGGG - Exonic
1193254222 X:79327171-79327193 CAGACAGGCGGGGCAGGAACAGG + Intergenic
1196126615 X:112108556-112108578 CAGGTGGGCAGGCCTGGAACTGG + Intergenic