ID: 1077905649

View in Genome Browser
Species Human (GRCh38)
Location 11:6530754-6530776
Sequence AGGCGGGCAAGGCAGGAACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 312}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077905640_1077905649 0 Left 1077905640 11:6530731-6530753 CCCTCCTCTTGTACAGGGGGTTC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1077905649 11:6530754-6530776 AGGCGGGCAAGGCAGGAACCGGG 0: 1
1: 0
2: 0
3: 22
4: 312
1077905634_1077905649 19 Left 1077905634 11:6530712-6530734 CCAGTGGGCCACTAAAACTCCCT 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1077905649 11:6530754-6530776 AGGCGGGCAAGGCAGGAACCGGG 0: 1
1: 0
2: 0
3: 22
4: 312
1077905643_1077905649 -4 Left 1077905643 11:6530735-6530757 CCTCTTGTACAGGGGGTTCAGGC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1077905649 11:6530754-6530776 AGGCGGGCAAGGCAGGAACCGGG 0: 1
1: 0
2: 0
3: 22
4: 312
1077905635_1077905649 11 Left 1077905635 11:6530720-6530742 CCACTAAAACTCCCTCCTCTTGT 0: 1
1: 0
2: 2
3: 19
4: 223
Right 1077905649 11:6530754-6530776 AGGCGGGCAAGGCAGGAACCGGG 0: 1
1: 0
2: 0
3: 22
4: 312
1077905641_1077905649 -1 Left 1077905641 11:6530732-6530754 CCTCCTCTTGTACAGGGGGTTCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1077905649 11:6530754-6530776 AGGCGGGCAAGGCAGGAACCGGG 0: 1
1: 0
2: 0
3: 22
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077905649 Original CRISPR AGGCGGGCAAGGCAGGAACC GGG Intronic
900238070 1:1601763-1601785 AGTGGGGCAGGGCAGGAGCCTGG + Intergenic
900242492 1:1623715-1623737 AGGCGGGACGGGCAGGACCCGGG + Intronic
900251825 1:1674969-1674991 AGGTGGGAGAGGCAGGAGCCTGG + Intronic
900262232 1:1737825-1737847 AGGTGGGAGAGGCAGGAGCCTGG + Intronic
900399999 1:2469133-2469155 AGGCCAGACAGGCAGGAACCAGG - Intronic
900767234 1:4513598-4513620 AGGAGGGGAAGGCAGGGCCCTGG - Intergenic
901460134 1:9386427-9386449 AGGCCTGCATGGCAGGGACCTGG - Intergenic
901684669 1:10937344-10937366 AGGCTGGCAAGGAAGGAAAGGGG - Intergenic
901794705 1:11673553-11673575 GGGAGGGGAAGGCAGGAGCCAGG - Intronic
901840441 1:11950742-11950764 AGGAGGGCAAGGGAGGAGTCAGG - Intronic
901876922 1:12172143-12172165 AAGCGGGCAAGGAGGGAAGCTGG + Intronic
901881803 1:12198559-12198581 AGACGGACACAGCAGGAACCTGG + Intronic
902609179 1:17587367-17587389 AGGTGGGCATGGCTGGAACTGGG - Intronic
902623750 1:17665001-17665023 ACCAGGGCAAGGCAGGACCCAGG - Intronic
902625055 1:17671625-17671647 AGCCCCTCAAGGCAGGAACCAGG - Intronic
903860105 1:26360006-26360028 AGGTGGGCCAGGCAGGCCCCCGG + Intergenic
906154368 1:43605504-43605526 GGGTGGGCAGGGCAGGAATCAGG - Intronic
906511329 1:46411859-46411881 AGGCGGCCAGGACAGGAGCCTGG - Intronic
907160475 1:52365709-52365731 AGGGGGAAAAGGCAGGAAGCCGG + Intronic
909312987 1:74176858-74176880 AGGAGGCCAAGTAAGGAACCAGG - Intronic
909945099 1:81655040-81655062 AGGGGGGCGAGGCTTGAACCTGG - Intronic
912491418 1:110064786-110064808 AGGCTGGCCAGGCAGGGGCCTGG + Exonic
915601166 1:156924118-156924140 AGGCGGCCCTGGCAGGCACCGGG - Intronic
918675421 1:187279094-187279116 AGGCTGGGAAGAAAGGAACCTGG - Intergenic
919470706 1:197975926-197975948 AGGAGGCCAAGACAGGAGCCTGG + Intergenic
919763052 1:201110444-201110466 CAGAGGTCAAGGCAGGAACCTGG - Intronic
921135106 1:212253048-212253070 AGGAGGCTGAGGCAGGAACCTGG + Intergenic
922723891 1:227913809-227913831 AGCAGGTCAGGGCAGGAACCTGG - Intergenic
922783057 1:228268728-228268750 AGGCGGGCCAGGCAGAGGCCGGG + Exonic
922899861 1:229128310-229128332 AGCCGGGGAAAGCAGAAACCAGG - Intergenic
924164764 1:241270125-241270147 AGGCGGGCAGAGCTGGCACCAGG - Intronic
924625025 1:245690252-245690274 AGGCCAGGAGGGCAGGAACCCGG - Intronic
1062843501 10:688809-688831 AGGACGGCAAGGCCGGAGCCCGG + Intronic
1063060246 10:2543899-2543921 AGGCAGGAAAGGCATGAACACGG - Intergenic
1063088412 10:2839933-2839955 AGGCAGGCTGGGCAGGAAGCTGG - Intergenic
1063666487 10:8063717-8063739 AGTCGGGCAAGCCAAGAACAGGG + Intronic
1063734315 10:8734960-8734982 AGGCTGGCAGGGCAGGACTCTGG + Intergenic
1065630447 10:27675879-27675901 AGTAGGGCAAGGCCAGAACCTGG - Intronic
1065664222 10:28040809-28040831 GGGGGTGAAAGGCAGGAACCAGG - Intergenic
1067409520 10:46052330-46052352 AGGCTGACAAGCCAGGGACCAGG + Intergenic
1068585753 10:58796448-58796470 AGGCCGGCAGGGCAGGATGCTGG - Exonic
1070862332 10:79683229-79683251 AGGCCGGCAAGGCAGGAGCTCGG + Intergenic
1072656145 10:97331900-97331922 AAAAGGGCAAGGCAGGAACTAGG + Intergenic
1072735182 10:97874339-97874361 AGGCGGGCATGGCATGGACTGGG - Intronic
1073205127 10:101765080-101765102 AGGGGGATAAGACAGGAACCAGG + Intergenic
1074867306 10:117552432-117552454 AGGCGGGCCAGGCAGAAAGGGGG + Intergenic
1074980945 10:118619656-118619678 AGTGGGGAAAGGCAGGAACGAGG + Intergenic
1075097778 10:119483950-119483972 AGGCGGGCAAGTACGGATCCAGG - Intergenic
1076840923 10:133044805-133044827 GGGCGGGGAAGGCAAGATCCAGG - Intergenic
1077068562 11:656558-656580 GGCCGGGCCAGGCAGGACCCTGG + Intronic
1077327515 11:1970091-1970113 AGGCCGGGAAGGCAGGGGCCTGG - Intronic
1077616518 11:3678668-3678690 AGGCTAGCAAGGCTGGAACGTGG + Intronic
1077890611 11:6415546-6415568 AGGAGGGCATTACAGGAACCTGG + Intronic
1077905649 11:6530754-6530776 AGGCGGGCAAGGCAGGAACCGGG + Intronic
1080172066 11:29316353-29316375 AGGCTGGCAAGACAGGAACTGGG - Intergenic
1080647482 11:34197463-34197485 TGGCGGGCAGGGCTGGCACCCGG + Exonic
1080793229 11:35539633-35539655 AGGCAGGCTGGGCAGGAACGTGG + Intergenic
1081703280 11:45165207-45165229 AGGCGAGGAGGGCAGGAACAAGG - Intronic
1081850633 11:46272900-46272922 AGGAGAGCAAAGCAGGAAGCGGG + Intergenic
1083544554 11:63538691-63538713 AGGTGGCCAAGACAGGAACCAGG + Intronic
1083795077 11:65012053-65012075 AGGAGGCCAAGGTGGGAACCAGG - Intergenic
1083813847 11:65120832-65120854 AGGTGTGGAAGACAGGAACCAGG - Intronic
1085012040 11:73147997-73148019 AGGAGGGCCAGGCAGGGATCAGG + Intergenic
1085025430 11:73233722-73233744 AGGAGGCCAAGGCAGAAACCAGG - Intronic
1085516188 11:77113190-77113212 AGGCGGGGAAGGCAGGCACGTGG - Intronic
1086958468 11:92958134-92958156 AGGCAGGCAAGGCAGGAGGAAGG + Intergenic
1089605783 11:119640459-119640481 AGGAGGGAAAGGCAGGAGCTGGG + Intronic
1089606846 11:119646266-119646288 AGTCGGGCAAGGGAGGAAAGAGG - Intronic
1091220713 11:133928507-133928529 AGGGGGAAAAGGCAGGCACCTGG - Intronic
1202810497 11_KI270721v1_random:25271-25293 AGGCCGGGAAGGCAGGGGCCTGG - Intergenic
1091616367 12:2053658-2053680 GCGCGGGTAGGGCAGGAACCCGG - Intronic
1092163341 12:6328021-6328043 AAGAGGGCAAAGCAGGAACAGGG + Intronic
1096574561 12:52544609-52544631 AGGCGGGGAGGGCAGGAGCCGGG - Exonic
1096717445 12:53499780-53499802 AGGCGGGCCAGGTACGAGCCTGG - Intronic
1101593129 12:106139920-106139942 AGGTGGGCAAACCAGGGACCTGG + Exonic
1101660257 12:106759219-106759241 GGGCAGGCATGGCAGGAGCCAGG + Intronic
1102201656 12:111061570-111061592 AGGCGGGCAAAGCAGGACGAGGG - Intronic
1102734222 12:115143872-115143894 AGGCTGGCAAGGGAGGCAGCAGG - Intergenic
1102950081 12:117025629-117025651 GGGCGGGCCAGGCAGTACCCAGG - Intronic
1103614929 12:122145922-122145944 AGGCGGGCGAGGCAGCGGCCAGG - Exonic
1104613975 12:130253464-130253486 AGGAGAGCTGGGCAGGAACCAGG + Intergenic
1105773678 13:23636793-23636815 AGGGGAGCAAGGGAGGAAGCAGG + Intronic
1106078345 13:26479846-26479868 AGGCCAGCAAGGCAGGTACCGGG + Intergenic
1114610486 14:24036799-24036821 AGGCAGGCAAGGGAGGGTCCAGG - Intergenic
1115180833 14:30624071-30624093 AGGCAGGCAAAGCAAGAAACAGG - Intronic
1118345919 14:64940816-64940838 GGGAGGGAAAGGCAGGGACCAGG - Intronic
1119201442 14:72755823-72755845 AGGAGGGCAAGGAAGGGGCCAGG - Intronic
1122592843 14:102867694-102867716 TGGCGGGCAAGGCTAGTACCAGG + Intronic
1122807615 14:104268143-104268165 AGGGGGGCAGTGCAGGAATCTGG - Intergenic
1124632544 15:31345767-31345789 AGGCTGGCAGGGCAGACACCCGG - Intronic
1125019421 15:34969929-34969951 AGGAGGGCAAGGGAGGGACCCGG + Intergenic
1125048299 15:35268850-35268872 AGGCTGGCAAGGTAGGAAGAGGG + Intronic
1127733719 15:61822628-61822650 AGGCAGGCAAGGCTGGGCCCAGG + Intergenic
1128357560 15:66938778-66938800 AGGAGGGCAGAGCAGGAAGCTGG + Intergenic
1128791697 15:70439067-70439089 AGGCGGGCGAGGCAGGCAGAGGG + Intergenic
1129168119 15:73790865-73790887 AGGAGGGCAGGACTGGAACCAGG - Intergenic
1129521636 15:76189989-76190011 AGGGTGGCCAGGCAGCAACCTGG - Intronic
1129521842 15:76191146-76191168 AGGGTGGCCAGGCAGCAACCTGG - Intronic
1129853948 15:78811211-78811233 CGCCGGGCATGGCAGGAACCGGG + Exonic
1129899793 15:79137861-79137883 AGCCGAGGAAGGCAGGAAACGGG + Intergenic
1132552985 16:560842-560864 AGGCGGGGAGGGCAGGGGCCGGG + Intronic
1132713661 16:1280054-1280076 AGGCGGGGTGGGCAGGAACAGGG + Intergenic
1133428633 16:5716013-5716035 AAGTGGGCAAGGCAGGAATAAGG + Intergenic
1134588778 16:15434990-15435012 AGGCAGCTAAGGCAGGAGCCTGG + Intronic
1134676448 16:16093862-16093884 AGGGGGGATGGGCAGGAACCAGG + Intronic
1135521461 16:23181821-23181843 AGGCAGGCAAGGAAGGAAGGAGG + Intergenic
1135743743 16:24998355-24998377 AGGCTGGCAAGGCAGCGCCCAGG + Intronic
1135978205 16:27125129-27125151 AGGCAGGAAAGGAAGGACCCTGG + Intergenic
1136042031 16:27587033-27587055 GGGCAGGCAAGGCAGGAGGCTGG + Intronic
1136919144 16:34246498-34246520 AGGAGGCCAAGGCAGGCAGCTGG + Intergenic
1137231033 16:46568534-46568556 AGGCAGGAAAGCCAGGACCCCGG + Intergenic
1138588126 16:57984898-57984920 CGGCGGGCCAGGCAGAAACAGGG + Intronic
1139507160 16:67404525-67404547 AGGCTGGTCAGGCATGAACCAGG + Intronic
1139558867 16:67729261-67729283 AGCAGAGCAAGGCAGGCACCTGG + Exonic
1141126544 16:81404608-81404630 AGCAGGGCAAGGCTGGAGCCAGG - Intergenic
1141484819 16:84331727-84331749 AGGCAGGGAAGGCAGTAATCAGG + Intergenic
1141572166 16:84940829-84940851 AGGCTGGCAAGGCGGGCACGGGG - Intergenic
1141841844 16:86578744-86578766 AGGCGGCCAGGGCAGGCAGCCGG - Exonic
1141946969 16:87317301-87317323 AGGAGGGAAAGGCGGGAGCCAGG - Exonic
1142236545 16:88925172-88925194 ATCCGGGCAGGGCTGGAACCCGG - Intronic
1143477175 17:7209324-7209346 AGGCGGACACGGAAGGACCCAGG - Intronic
1143628024 17:8122060-8122082 AGGTGGGCAGGGCAGGGGCCCGG + Intronic
1144439156 17:15265828-15265850 AGGCAGACAAGGCAGGTAACAGG - Intergenic
1144480184 17:15622418-15622440 AGGAGGGCAAGGAATGAACTGGG + Intronic
1144503556 17:15809745-15809767 AGGAGGGCAAGGCAGCAGGCAGG + Intergenic
1144918122 17:18741320-18741342 AGGAGGGCAAGGAATGAACTGGG - Intergenic
1145166593 17:20617422-20617444 AGGAGGGCAAGGCAGCAGGCAGG + Intergenic
1145897772 17:28470517-28470539 AGGGGGGCTAGGGAGGCACCTGG - Intronic
1146057732 17:29589533-29589555 AGGCGGGCACGGCGGGTTCCGGG - Exonic
1146279611 17:31536730-31536752 AAGCGGGAGAGGCTGGAACCAGG + Exonic
1146402456 17:32510663-32510685 AGGTGGGCCAGGCAGGGACTCGG + Intronic
1146703275 17:34980721-34980743 AGGCGGGCGGGGGAGGAGCCGGG - Intronic
1147256525 17:39185215-39185237 CAGAGGGCAAGGCAGGAGCCAGG + Intronic
1148780027 17:50116119-50116141 AGGCAGGCAGGGCAGCAAACAGG - Intronic
1148994773 17:51700199-51700221 AGGCGGCCACTGCAGCAACCCGG - Intronic
1149642130 17:58209839-58209861 ATGGGAGCAAGGCAGGAAGCAGG + Intronic
1150719146 17:67599433-67599455 AGAAGGGCAAGGATGGAACCTGG + Intronic
1151728385 17:75897180-75897202 AGGGGCGCAAGGCGGGAACGCGG - Intergenic
1151829363 17:76540568-76540590 AGGCAGGTAAGGCAGGAGTCTGG + Exonic
1151882497 17:76903862-76903884 AGGCGGCCAGGGCTGGAGCCAGG - Intronic
1152751939 17:82066234-82066256 GGGCGGGCAAGGAAGGTCCCTGG - Intergenic
1152787995 17:82261718-82261740 AGGTGGGCAGGGCAGGGTCCTGG + Intronic
1152899717 17:82933486-82933508 AGGAGGCCAAGGCAGGCACTTGG - Intronic
1154315940 18:13303457-13303479 AGGAGGGCAGGGAAGGAAACGGG - Intronic
1157412962 18:47479192-47479214 AGGCAGGAAAGGCAGGCACCAGG + Intergenic
1162834643 19:13308284-13308306 AGGCGGGGGAGGCAGGGCCCCGG + Intronic
1162937246 19:13987340-13987362 AGGCAGGGCAGGCAGGGACCGGG + Intronic
1163276366 19:16286750-16286772 AGGCAGGCAGGGCAGGACCCTGG - Intergenic
1165460923 19:35943943-35943965 AGGAGGCCAAGGCAGGAGGCTGG + Intronic
1167153273 19:47722418-47722440 TTGCGGGCAACGCAGGGACCGGG - Intronic
1167254883 19:48421479-48421501 AGGCTGGCATGGCAGGAGCTGGG - Intronic
1167427092 19:49434929-49434951 GGGCGGGAAAGGCAGAATCCCGG - Intronic
1168241782 19:55092377-55092399 GGGCGGGGAAGCCAGGAAGCTGG + Intronic
1168345648 19:55649068-55649090 AGGCGGACAAGTGAGGAAGCTGG + Exonic
926695650 2:15768671-15768693 AGGTGTGCAAAGCAGGAAGCAGG + Intergenic
926843516 2:17108020-17108042 AGGCAGTCAAGGAAGGAGCCAGG + Intergenic
927201916 2:20583325-20583347 TGGAGAGCCAGGCAGGAACCAGG + Intronic
927201935 2:20583403-20583425 TGGAGAGCCAGGCAGGAACCAGG + Intronic
927454531 2:23238105-23238127 AGGCAGGCAAGAAAGGAGCCAGG + Intergenic
927901594 2:26823395-26823417 AGGCGGGAATGGCATGAACCCGG + Intergenic
929592341 2:43155445-43155467 AGGAGGGCAGGGCAGGAGGCAGG - Intergenic
930517363 2:52424734-52424756 AGGAGGGCAAGGAAGGAAGGAGG + Intergenic
932423438 2:71614436-71614458 AGGCTGGCAGGGCAGAACCCTGG - Intronic
932448747 2:71796371-71796393 AGGCGGCAAAGGCAGGCAGCTGG - Intergenic
935131478 2:100264385-100264407 AGGGAGGCAAGGGAGGAACGGGG + Intergenic
935423478 2:102894893-102894915 AGGCTGGAAGGGCAGGAACTGGG + Intergenic
936015842 2:108958517-108958539 AGGGGGGCATGGCAAGACCCTGG + Intronic
936641631 2:114318246-114318268 AGGAAGGCAAGGCAGGAGCAAGG - Intergenic
937038350 2:118801336-118801358 AGCTGGGAAAGGCAGGAGCCTGG - Intergenic
937240394 2:120457090-120457112 TGGAGGCCAAGGGAGGAACCTGG + Intergenic
937631088 2:124101938-124101960 AGAGGGGCAAGTCAGGCACCAGG - Intronic
937861430 2:126714491-126714513 AAGCTGGCAAGGTAGAAACCTGG + Intergenic
937870257 2:126781360-126781382 AGCCGGGACAGGCAGGACCCGGG + Intergenic
937870268 2:126781392-126781414 ACCCGGGAAAGGCAGGACCCGGG + Intergenic
938381014 2:130836771-130836793 GGGCGGGCAGGGCAGGAGCCTGG + Intergenic
938698220 2:133853776-133853798 AGGAGGGTAAGGCAGGAAGACGG + Intergenic
939039965 2:137176846-137176868 AGGCAGGAAAGGGAGGAGCCTGG - Intronic
939630533 2:144522881-144522903 GGGCGTGCCAGTCAGGAACCAGG - Intronic
944316700 2:198292441-198292463 ATGAGGCCATGGCAGGAACCCGG - Intronic
944937452 2:204584042-204584064 AGCCAGGCAAGGCTGGAGCCAGG + Intronic
946185131 2:217976521-217976543 AGACTGGCAGGGCAGCAACCAGG - Intronic
946321161 2:218955337-218955359 AGGAGGTGAAGGCAGGAGCCAGG + Intergenic
947533720 2:230928140-230928162 AAGCTGGCCAGGCAGGAACCAGG + Intronic
948130671 2:235598248-235598270 AGTGGGGGCAGGCAGGAACCAGG - Intronic
948518894 2:238523348-238523370 ATGGGAGCAAGGCAGGGACCCGG - Intergenic
948560233 2:238847294-238847316 AGGCGGGCGCGGCGGGTACCGGG + Intergenic
948592344 2:239059493-239059515 AGACGTGAAAGGCAGGAAACTGG + Intronic
948640142 2:239370529-239370551 GGGCTGGCAAGGCAGGGAGCAGG - Intronic
948815936 2:240510327-240510349 AGGCGGGAAGGGCAGGGACGGGG - Intronic
1168949368 20:1786158-1786180 AGGTGGGTAAGGAAGGAAGCAGG + Intergenic
1168964481 20:1891005-1891027 GCGCGGGCAGGGCTGGAACCAGG + Intergenic
1168965760 20:1896928-1896950 AGGATGGCAGGGCAGGAACTCGG - Intronic
1169479865 20:5969846-5969868 AGGTGGCCAAGGAAGCAACCTGG + Intronic
1170422924 20:16210422-16210444 AGGTGGGCAAGGGAGGGAGCAGG - Intergenic
1171114723 20:22515449-22515471 AGGCAGGCAAGGCCTGCACCTGG - Intergenic
1171150072 20:22820039-22820061 CTGGGGGCAAGGCAGGCACCAGG - Intergenic
1171456320 20:25274742-25274764 CTGCGGGCAAGGCTGGAGCCAGG + Intronic
1171562504 20:26137664-26137686 AGGAGGCCAAGGCAGGAAAATGG - Intergenic
1172144834 20:32749647-32749669 AGGCGGGCAGGGCCTGGACCCGG - Intergenic
1172612841 20:36264624-36264646 ATGCAGGCAAGGCTGGATCCAGG - Intronic
1172980757 20:38939819-38939841 GGGAGGGCAAGGCAGGAAACAGG - Intronic
1174353480 20:49983663-49983685 GGGCGAGGAGGGCAGGAACCTGG + Intronic
1175102465 20:56589220-56589242 AGTCTTGCAAGGCAGGAAACTGG + Intergenic
1175144257 20:56883813-56883835 AGAAGTGCAAGGCAGGGACCAGG + Intergenic
1175171113 20:57082184-57082206 GGGAGGGCAGGGCAGGGACCTGG + Intergenic
1175212585 20:57370346-57370368 AGGCTGGCAAGACAGCAGCCAGG - Intronic
1175877819 20:62238696-62238718 GGGCGGGCCGGGCAGGACCCGGG + Intronic
1175972284 20:62692690-62692712 AGGCCGGGCAGGCAGGAACAGGG + Intergenic
1176200533 20:63858371-63858393 AGGCCGGAGGGGCAGGAACCAGG - Intergenic
1179294870 21:40052802-40052824 AGGTGAGCGAGGCAGGAGCCTGG + Intronic
1179586086 21:42375146-42375168 AGGCTGGCTTGGCAGGACCCGGG - Intronic
1179798406 21:43798953-43798975 AGAAGGGCAAGGCAGAGACCAGG - Intronic
1179833022 21:44010238-44010260 AGGCCGGCAAGGCAGGGCACTGG - Intergenic
1180067884 21:45421691-45421713 AGGCAGGCACGGCAAGTACCCGG - Intronic
1181014696 22:20062268-20062290 AGGCTGGCATGGCAAGCACCAGG - Intronic
1181594969 22:23908242-23908264 AGACAGGCAAGGCAGGGCCCAGG + Intergenic
1182285554 22:29245000-29245022 AAGAGGGCAAGGCAGGCACTGGG - Intronic
1183184162 22:36282337-36282359 AGGCGAGCAGGGCAGGCCCCCGG - Exonic
1183349935 22:37329490-37329512 AGCCAGGCAGGGCAGGAGCCAGG + Intergenic
1183372368 22:37441036-37441058 AGGCTGGGAAATCAGGAACCAGG - Intergenic
1183467368 22:37986496-37986518 AGGAGGGCAAAGGAGGAAGCAGG - Intronic
1184042947 22:41955074-41955096 AGGCGGAGAAGGCAGGAAAGTGG - Intergenic
1184298477 22:43541159-43541181 AGGATGGGAAGGAAGGAACCAGG - Intronic
1184348269 22:43926036-43926058 AGGGGGTTAAAGCAGGAACCTGG - Intronic
1184893758 22:47395040-47395062 AACCTGGCAAGGCAGGAACCAGG - Intergenic
1184924336 22:47626557-47626579 GGGCTGGCAAGGCAGGAAGGAGG - Intergenic
1184941547 22:47769793-47769815 AGGAGGGCATGGCAGGAAGTGGG - Intergenic
1185088825 22:48754895-48754917 ATGCGGGCAGTGCAGGACCCTGG - Intronic
1185088867 22:48755013-48755035 ACGCAGGCAATGCAGGACCCTGG - Intronic
950184173 3:10934916-10934938 AGGCTGGCAGGGGAGGAAGCTGG - Intronic
950496183 3:13335814-13335836 ATGCAGGCAGGGCAGGACCCGGG - Intronic
950677229 3:14561650-14561672 AGGCGGGGATGGCAGCAACCTGG - Intergenic
953119748 3:40027955-40027977 AGGGGGTCAGGGCAGGAAGCGGG + Intronic
953653927 3:44832908-44832930 AGGAGGCCAAGGCAGGAAAATGG + Intronic
954447236 3:50553321-50553343 GGGCTGGCAGGGCAGGGACCTGG - Intergenic
960906447 3:122606516-122606538 AGGAGGGGTAGGCAGGAGCCAGG - Intronic
961355986 3:126340333-126340355 AGGAGGGCAGGGCAGAAACATGG + Intergenic
962076736 3:132090050-132090072 AAGAGGGCAAGGGAGGAAGCAGG - Intronic
962143671 3:132817669-132817691 AGGAAGGCAAGGCTGGAAGCAGG + Intergenic
962368743 3:134803552-134803574 AGGCTGGCAATGCTGGATCCAGG + Intronic
963779283 3:149470894-149470916 AAGCGGGCAGAGCAGGAAGCAGG + Intergenic
964414277 3:156431132-156431154 AGGAGGGAAAGGCAGGCACTAGG - Intronic
965668917 3:171126103-171126125 AGGCGGTCAAGGCAGGTCCCTGG + Exonic
967423359 3:189298216-189298238 AGGCGGGCAAAGAAGGAAAATGG - Intronic
968279480 3:197465276-197465298 AGGCAGGCAGAGCGGGAACCGGG + Intergenic
968444244 4:641406-641428 AGGCGGTCAGCGCAGGAGCCAGG + Intronic
969116191 4:4872115-4872137 AGGAAGGCAAGGGAGCAACCCGG + Intergenic
969475761 4:7421764-7421786 AGGAGGCCAAAGCAGGAACAGGG - Intronic
970249056 4:14094695-14094717 AGGCGGGCCAGGCAGGATCAGGG + Intergenic
970447416 4:16135798-16135820 AGGCACGCAAGGCAGGGTCCAGG + Intergenic
971275741 4:25194893-25194915 AAGCAGGCAAGACAGGAAACAGG + Intronic
972548336 4:40104046-40104068 AGGCAGGAATGGCATGAACCTGG - Intronic
977045564 4:92064806-92064828 AGGAGAGCAAGGCTGGAGCCGGG - Intergenic
980111344 4:128640284-128640306 AGGCTGGCATGTCAGGAACTCGG - Intergenic
980973191 4:139586189-139586211 AGGCAGGCAATGCAGAAACATGG - Intronic
983821811 4:172203576-172203598 TGGGAGGCAAGGCAGGAATCAGG + Intronic
983887713 4:172999094-172999116 ATGTGAGCAAGGCAGGAACTTGG + Intronic
984184836 4:176531245-176531267 TGCCAGGCAAGGCAGGAATCAGG + Intergenic
992104315 5:73437205-73437227 AGGCGGGGAAGGGAGCAGCCCGG + Intergenic
992889154 5:81188116-81188138 AGGAGGGCAGGGCTGGAAGCAGG - Intronic
993463719 5:88218546-88218568 GGAAGGCCAAGGCAGGAACCTGG + Intronic
997362840 5:133306064-133306086 AGGCTGGCAAGGCAGGCCTCTGG - Intronic
997657295 5:135564760-135564782 AGGCAGGCCAGGCTGGAACAGGG + Intergenic
998372168 5:141668926-141668948 AGGAGGGAAAGGAAGGCACCAGG + Intronic
998390966 5:141786877-141786899 CGGGGGGCAAGGCAGGCACTGGG - Intergenic
998614064 5:143720188-143720210 AGGAGGGCAAGACTGGAACAGGG + Intergenic
1002108522 5:176892440-176892462 AGGCAGGGAAGGCAGAAGCCAGG + Intronic
1002450623 5:179316458-179316480 AGGGGGCCTAGGCAGGAGCCTGG - Intronic
1002640986 5:180630521-180630543 AGGCGGGCCAGGCTGGAGCAGGG - Intronic
1003260414 6:4511237-4511259 AGGTGGGGAAGCCAAGAACCTGG + Intergenic
1003514052 6:6803857-6803879 AGGCCGGGCAGGGAGGAACCTGG + Intergenic
1004299288 6:14442549-14442571 AGGAGGGCAAGCCAGGATCTTGG + Intergenic
1005724493 6:28635435-28635457 AGGCGGGCAAGAAAGAAAACCGG - Intergenic
1006021730 6:31121415-31121437 AGGAGGGCCAGGCAGGCTCCCGG + Intronic
1007380190 6:41485164-41485186 AGGAGGGCAGGCAAGGAACCGGG + Intergenic
1007381263 6:41491712-41491734 AGGAGGTGAAGACAGGAACCAGG + Intergenic
1010507449 6:76677607-76677629 AGGGGAGAAAGGCAGGCACCTGG - Intergenic
1018475394 6:164135286-164135308 AGCCAGGCAAGGCAGGAGCACGG - Intergenic
1018571964 6:165221497-165221519 AGGGAGCCATGGCAGGAACCAGG - Intergenic
1018706395 6:166466542-166466564 AGGTGGGCAGGGCAGCATCCTGG - Intronic
1018778521 6:167042054-167042076 AGGAGGCTAAGGCAGGAACGAGG - Exonic
1019604509 7:1901774-1901796 GGGCAGGGAAGGCAGGAGCCAGG - Intronic
1021956021 7:25825236-25825258 ATGTGTGCATGGCAGGAACCCGG - Intergenic
1023694481 7:42830521-42830543 TGGCCTGCAAGGCAGGAAGCTGG + Intergenic
1023995781 7:45158085-45158107 TGGCGGGCAAGGGAGGCACAGGG + Intronic
1024011659 7:45271994-45272016 AGGGGAGCAAGGCAGGAAGTAGG - Intergenic
1024569060 7:50709391-50709413 AGCCAGGCCAGGCAGGAACATGG + Intronic
1026349965 7:69507205-69507227 AGGAGGCCAAGGCAGGAAGACGG + Intergenic
1027438849 7:78196664-78196686 AGGTGGGCAGGGCAGGCCCCTGG - Intronic
1027770867 7:82404288-82404310 AAGAGGGCACGGCAGGAACATGG + Intronic
1028117693 7:87019266-87019288 AGGAGGGCAAGGCAGGAAGATGG - Intronic
1029422416 7:100478174-100478196 AGGAGGGCCTGGCGGGAACCGGG + Exonic
1031542581 7:123013064-123013086 GTGCGGGTCAGGCAGGAACCTGG - Intergenic
1032444723 7:131972399-131972421 AGGCAGGGAAAGCAGGAGCCAGG - Intergenic
1032482268 7:132256547-132256569 AGGAGGGAAAGGCAGGAATTTGG + Intronic
1033457321 7:141514441-141514463 AGGGGAGCAAGGCTGGAAGCAGG - Intergenic
1034397519 7:150838504-150838526 TGGAGAGCAAGGCTGGAACCTGG + Intronic
1034528422 7:151680728-151680750 GGGCAGGCAGGGCAGGAAGCAGG - Intronic
1035288401 7:157821078-157821100 AGGCAGGCATGGCAGGATCTAGG + Intronic
1035345221 7:158192942-158192964 AGCTGGAAAAGGCAGGAACCAGG + Intronic
1036773171 8:11592656-11592678 CGGCGGGCGAGGCAGCATCCTGG - Intergenic
1037272605 8:17146138-17146160 ATGTGGACAAGCCAGGAACCCGG - Intergenic
1040387524 8:46923611-46923633 AGGCAGGCAGAGCAGGGACCAGG + Intergenic
1040542890 8:48375632-48375654 AGGCAGGCATGGCAGGGGCCTGG + Intergenic
1040902037 8:52427491-52427513 AAGCGGACAAGGCAGAAGCCAGG + Intronic
1041955608 8:63555604-63555626 AGGAGGCCAAGGCAGGAAAATGG - Intergenic
1045294278 8:100860319-100860341 AGCAGGGCCAGGCAGGACCCAGG + Intergenic
1045501744 8:102748966-102748988 AGGAGCCCAAGCCAGGAACCTGG - Intergenic
1045905344 8:107338188-107338210 AAGGGAGCAAGGCAGGAACTAGG + Intronic
1048476952 8:134752177-134752199 GGGTGGGCAAGGCAGAAAGCAGG - Intergenic
1049055022 8:140229660-140229682 GGGAGGCCAAGGCATGAACCTGG - Intronic
1049278119 8:141730099-141730121 GGGTGGGCAAGGCAGGAGCTGGG - Intergenic
1049387342 8:142349970-142349992 GGGCAGGCAAGGCTGGGACCAGG + Intronic
1049387353 8:142350000-142350022 GGGCGGGCAAGGCTGGGACCAGG + Intronic
1049387365 8:142350030-142350052 GGGCGGGCAGGGCTGGGACCAGG + Intronic
1049387392 8:142350108-142350130 GGGCAGGCAAGGCTGGGACCAGG + Intronic
1049387434 8:142350219-142350241 GGGCGGGCAGGGCTGGGACCAGG + Intronic
1049618863 8:143588893-143588915 AGGTGGGCAGGGGAGGAAGCTGG + Intronic
1049686553 8:143941483-143941505 ACTCGGGCAAGGCTGGGACCGGG + Intronic
1050094160 9:2047031-2047053 AGGAGGGCAAGACAGGGAACGGG - Intronic
1052283471 9:26758371-26758393 AGAAGGGCAAGGGAAGAACCGGG + Intergenic
1056809771 9:89755150-89755172 AGAAGGGCTAGGGAGGAACCAGG - Intergenic
1056967907 9:91179653-91179675 AGCCGGGCCAGGCTGGAAACAGG + Intergenic
1059264902 9:113018181-113018203 AGGAGGCTGAGGCAGGAACCCGG + Intergenic
1060028985 9:120197926-120197948 GAGTGGGCAAGGCAGGGACCTGG + Intergenic
1061076568 9:128345065-128345087 AGGCTGGCGAGGCAGCAGCCTGG + Intronic
1061951636 9:133939561-133939583 AGGGCGGCAAGGCAGCACCCTGG + Intronic
1062162429 9:135087717-135087739 AGCCGGGCAAGGCAGGGCGCAGG + Exonic
1062658073 9:137614406-137614428 ACTGGGGCAAGGCAGGCACCAGG - Exonic
1187023280 X:15406736-15406758 AGGAGACCCAGGCAGGAACCAGG + Intronic
1188011225 X:25058167-25058189 AGACAGGCAACCCAGGAACCAGG - Intergenic
1188107333 X:26160536-26160558 AGGTTGGCAAGGCTGGCACCTGG - Intergenic
1189366706 X:40394516-40394538 GGCCGGGGAAGGTAGGAACCTGG - Intergenic
1193320912 X:80120049-80120071 AGGAGGGCAAGGTGGGAAGCAGG + Intergenic
1195273116 X:103252716-103252738 GGGCAGGCATGGCAGGAACCAGG + Intergenic