ID: 1077905650

View in Genome Browser
Species Human (GRCh38)
Location 11:6530757-6530779
Sequence CGGGCAAGGCAGGAACCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077905640_1077905650 3 Left 1077905640 11:6530731-6530753 CCCTCCTCTTGTACAGGGGGTTC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1077905650 11:6530757-6530779 CGGGCAAGGCAGGAACCGGGAGG 0: 1
1: 1
2: 0
3: 15
4: 173
1077905634_1077905650 22 Left 1077905634 11:6530712-6530734 CCAGTGGGCCACTAAAACTCCCT 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1077905650 11:6530757-6530779 CGGGCAAGGCAGGAACCGGGAGG 0: 1
1: 1
2: 0
3: 15
4: 173
1077905643_1077905650 -1 Left 1077905643 11:6530735-6530757 CCTCTTGTACAGGGGGTTCAGGC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1077905650 11:6530757-6530779 CGGGCAAGGCAGGAACCGGGAGG 0: 1
1: 1
2: 0
3: 15
4: 173
1077905641_1077905650 2 Left 1077905641 11:6530732-6530754 CCTCCTCTTGTACAGGGGGTTCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1077905650 11:6530757-6530779 CGGGCAAGGCAGGAACCGGGAGG 0: 1
1: 1
2: 0
3: 15
4: 173
1077905635_1077905650 14 Left 1077905635 11:6530720-6530742 CCACTAAAACTCCCTCCTCTTGT 0: 1
1: 0
2: 2
3: 19
4: 223
Right 1077905650 11:6530757-6530779 CGGGCAAGGCAGGAACCGGGAGG 0: 1
1: 1
2: 0
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077905650 Original CRISPR CGGGCAAGGCAGGAACCGGG AGG Intronic
900005990 1:51773-51795 GGAGCATGGCGGGAACCGGGAGG + Intergenic
900172106 1:1274154-1274176 AGGACAAGGCGGGAGCCGGGAGG - Intergenic
900205716 1:1431187-1431209 GGGGCCAGGCAAGAACCCGGGGG - Intergenic
900557981 1:3289607-3289629 CGGGCAGGTCAGGAGCTGGGCGG + Intronic
900609500 1:3538512-3538534 GGGGCCAGGCAGAAACAGGGGGG + Intronic
901216510 1:7558310-7558332 CAGGCATGGCAGGAAGAGGGGGG + Intronic
901684668 1:10937341-10937363 CTGGCAAGGAAGGAAAGGGGAGG - Intergenic
901881804 1:12198562-12198584 CGGACACAGCAGGAACCTGGAGG + Intronic
902581096 1:17408128-17408150 CGCGCGAGGCAGGATCCAGGCGG + Exonic
903010682 1:20328009-20328031 GGGGCAAGGCTGGGACCAGGAGG + Intronic
903466293 1:23554668-23554690 CGGACGGGGCAGGAAGCGGGTGG + Intergenic
903818013 1:26079337-26079359 CGGGCCAGGCGGGAATCAGGGGG - Intergenic
904478128 1:30777506-30777528 AGGGCAGGGCAGGGGCCGGGCGG + Intergenic
904481804 1:30798634-30798656 GGGGCCAGGCAGGAACTGGGAGG - Intergenic
905209268 1:36362255-36362277 TTGGCAAAGCAGGATCCGGGGGG + Intronic
912243869 1:107940503-107940525 CTGGCAAGGCTGAAACCAGGAGG - Intronic
915076213 1:153309789-153309811 CTGGCAGGGCAGGAACCAGGAGG + Intronic
915742243 1:158127724-158127746 CTGGCAATGGAGGAACAGGGTGG + Intergenic
917645964 1:177029098-177029120 GGGGAAAGGAAGGAACTGGGAGG + Intronic
918048252 1:180954055-180954077 CGGCCAGGGCAGGCAGCGGGCGG + Intergenic
919103434 1:193121624-193121646 CGGCCAAAGCAGGGACCCGGGGG + Intergenic
1063035611 10:2284108-2284130 AGGGCAAGGCAGGAATGCGGTGG + Intergenic
1065189825 10:23199014-23199036 CGGGCTCGGCAGGAGCCGGAGGG - Intergenic
1065664219 10:28040806-28040828 GGTGAAAGGCAGGAACCAGGGGG - Intergenic
1066470148 10:35690056-35690078 TGGGGGAGGCAGGAACAGGGTGG + Intergenic
1069561640 10:69435103-69435125 AGGGCAAGCCAGGAACAGAGCGG + Intergenic
1072970066 10:100009806-100009828 CGGGCCAGGCCGGAGCCGGGCGG - Intronic
1073444237 10:103571298-103571320 GTGACAAGGAAGGAACCGGGAGG + Intronic
1075182248 10:120222138-120222160 TGGGCATGGCAGGAGCTGGGTGG - Intergenic
1075980180 10:126731652-126731674 TGGGCAAGGCAGCAACCTGTGGG + Intergenic
1076794799 10:132793306-132793328 GGGGCCATGCAGGACCCGGGAGG - Intergenic
1077905650 11:6530757-6530779 CGGGCAAGGCAGGAACCGGGAGG + Intronic
1080804339 11:35638499-35638521 AGGGAGAGGCAGGAACTGGGAGG + Intergenic
1081661660 11:44892199-44892221 GGGGAAAGGCAGGTACCAGGAGG - Intronic
1081850634 11:46272903-46272925 AGAGCAAAGCAGGAAGCGGGTGG + Intergenic
1085560968 11:77473245-77473267 CAGGCCAGGCTGGAGCCGGGAGG - Intronic
1087136680 11:94727949-94727971 CAGGCAATGCAGGAACCCGCAGG + Intronic
1089605784 11:119640462-119640484 AGGGAAAGGCAGGAGCTGGGAGG + Intronic
1090082373 11:123622592-123622614 TTGACAAGGCAGGAACAGGGTGG + Exonic
1090334404 11:125953154-125953176 GGGGCAGGGAAGGAACAGGGAGG + Intergenic
1091224066 11:133947114-133947136 CGAGCAAGGCAGCAGGCGGGAGG + Intronic
1091616366 12:2053655-2053677 CGGGTAGGGCAGGAACCCGGTGG - Intronic
1091803448 12:3339708-3339730 AGGGCAAGGCAGGAAGGGGTGGG + Intergenic
1091803469 12:3339792-3339814 AGGGCAAGGCAGGAAGGGGTGGG + Intergenic
1102484661 12:113247595-113247617 AGGGCACGGCAGGGGCCGGGTGG - Intronic
1103601771 12:122058993-122059015 CAGCCAAGGAAGGAACCGAGCGG - Intronic
1105849908 13:24323964-24323986 GTGTCAAGGCAGGGACCGGGTGG - Intergenic
1107115034 13:36737911-36737933 CGGGAAAAGCAGGAACCCTGAGG + Intergenic
1107916515 13:45157480-45157502 GGGGCAGGGCTGGAACCGGGAGG + Intronic
1109253754 13:60052175-60052197 AGGGCATGGCAGGAACAGGGAGG + Intronic
1113927870 13:113951345-113951367 CGGGCCGGGCTGGAGCCGGGCGG + Intergenic
1118720586 14:68590989-68591011 TGGGCAGGGCAGGAACCGGAGGG - Intronic
1118793949 14:69122625-69122647 CTGGAAAGACAGGAACAGGGTGG - Intronic
1120006952 14:79369216-79369238 CGGGCCAGTCAGGAACAGGTGGG + Intronic
1121316972 14:92967899-92967921 TGGGGAAGGAAGGAACTGGGAGG + Intronic
1121739096 14:96238870-96238892 CAGGCAGGGCAGGGGCCGGGTGG + Intronic
1122723666 14:103736363-103736385 CGGGCAGGGGAGGTATCGGGTGG - Intronic
1125019422 15:34969932-34969954 AGGGCAAGGGAGGGACCCGGTGG + Intergenic
1125577992 15:40768067-40768089 CGGACAGGGCAGGGACAGGGAGG + Intronic
1128242136 15:66108282-66108304 GGGGCAAGGCAGGAATAGAGTGG + Intronic
1128815301 15:70603753-70603775 TGTGCAAGGCAGGAACTGTGGGG + Intergenic
1129853950 15:78811214-78811236 CGGGCATGGCAGGAACCGGGCGG + Exonic
1131263517 15:90902628-90902650 CGGGCCCGGGAGGAGCCGGGCGG + Intronic
1132240266 15:100252476-100252498 GGGGCAAGCCAGGAAGCAGGAGG + Intronic
1132447525 15:101939150-101939172 GGAGCATGGCGGGAACCGGGAGG - Intergenic
1136224031 16:28846658-28846680 CGGGCTAGGCCGGACCCGGAGGG + Intronic
1136570826 16:31095537-31095559 CTGGTGAGGCAGGACCCGGGAGG - Intronic
1138588127 16:57984901-57984923 CGGGCCAGGCAGAAACAGGGCGG + Intronic
1139276083 16:65728762-65728784 TGGGCATGGGAGGAACAGGGAGG - Intergenic
1139427705 16:66893427-66893449 GGAGCAAGGCAGGAAGTGGGAGG + Intronic
1142192214 16:88723240-88723262 CAGGCAAGGCAGGAACAGGCAGG - Exonic
1142206174 16:88784282-88784304 AGGGCAAGGGAGGACCAGGGAGG + Intronic
1142547507 17:714945-714967 CGGGCAACGCAGTATCCCGGCGG + Intronic
1142614879 17:1128242-1128264 CGGAGAAGGCAGGAACCCTGGGG + Intronic
1144396373 17:14847518-14847540 AGGGGAAGGAAGGAACAGGGAGG - Intergenic
1145014031 17:19385338-19385360 TGGGTAAGGCAGGGACCAGGTGG - Exonic
1146371325 17:32266764-32266786 GCGGCAAGGCAGGTGCCGGGCGG - Intronic
1146703272 17:34980718-34980740 CGGGCGGGGGAGGAGCCGGGGGG - Intronic
1147313210 17:39606889-39606911 GGGTCAGGGCAGGGACCGGGTGG + Intronic
1148087052 17:45000617-45000639 CAGGCAAGGCAGGGACAGGATGG + Intergenic
1148862061 17:50609647-50609669 CGGGGCAGGGAGGCACCGGGAGG - Intronic
1149461836 17:56834706-56834728 CCGGAAAGGCAGGAAGGGGGCGG + Intronic
1149642133 17:58209842-58209864 GGAGCAAGGCAGGAAGCAGGGGG + Intronic
1150216829 17:63475998-63476020 GGGGCAATGGAGGAACCGTGGGG - Intergenic
1150719149 17:67599436-67599458 AGGGCAAGGATGGAACCTGGGGG + Intronic
1152396577 17:80036657-80036679 CGGGAAATGGCGGAACCGGGCGG + Exonic
1152492906 17:80649889-80649911 AGGGCAAGGCAGGAAGTGCGTGG - Intronic
1152751938 17:82066231-82066253 CGGGCAAGGAAGGTCCCTGGAGG - Intergenic
1154414605 18:14170454-14170476 AGGGCAGGGCAGGGACAGGGTGG + Intergenic
1155096358 18:22559793-22559815 CGGGCCGGGTCGGAACCGGGCGG - Intergenic
1157499211 18:48178182-48178204 GGGGCATGGCAGGAAACAGGTGG - Intronic
1160637747 19:93379-93401 GGAGCATGGCGGGAACCGGGAGG + Intergenic
1160904628 19:1446377-1446399 CGGGCCGCGCAGGAACGGGGCGG + Intronic
1160946689 19:1647067-1647089 CGGGCCCGGCAGGAAGCTGGAGG + Intronic
1161719162 19:5893846-5893868 CGGGGACAGCAGGAACCGGCAGG - Intronic
1162235965 19:9309751-9309773 AGGGCAGGACAGGAAGCGGGCGG + Intronic
1162456506 19:10788287-10788309 AGGGCAGGGCAGGAGCCGTGTGG + Intronic
1163725588 19:18921551-18921573 TGGGCAAGTCAGGAGCCTGGGGG + Intronic
1168568274 19:57442519-57442541 CGGGAAAGGCAGGGAAAGGGAGG - Intronic
1168669366 19:58229260-58229282 CGGGCAGGGGTGGAACTGGGTGG + Intronic
925130078 2:1488488-1488510 TGGGAAAGGCAGGAGCCGGGTGG - Intronic
925923557 2:8654344-8654366 AGGGCAAGGCAGGAACAGGCAGG - Intergenic
926226808 2:10972774-10972796 CGGGCAAGTCATGTACCCGGAGG + Intergenic
929603805 2:43221387-43221409 CGGCTAAGGCAGGGCCCGGGAGG + Intergenic
933727667 2:85435800-85435822 CCGGGAGGGCAGGAACCGTGAGG + Exonic
934323717 2:91986949-91986971 ATGGCAAGGCAGGGACAGGGAGG - Intergenic
934553720 2:95276864-95276886 CGGGCTCTGCAGGAGCCGGGGGG - Intronic
937631087 2:124101935-124101957 GGGGCAAGTCAGGCACCAGGCGG - Intronic
938079681 2:128363067-128363089 CGGGGAAGGCAGGAGCGGTGCGG + Intergenic
938128465 2:128691054-128691076 AGGGCAAGACAGGAACCACGTGG - Intergenic
938501291 2:131832387-131832409 CGGGCGAGGCAGGAGCAGGTGGG + Intergenic
941109508 2:161403384-161403406 TGGGCAAGGCAGGAATGGGGAGG + Intronic
941422531 2:165300690-165300712 TGGGAAAGGCAGGAAGCGAGAGG + Intronic
942070590 2:172312256-172312278 CATGCAGGGCAGGAACCGGAGGG - Intergenic
947399223 2:229714892-229714914 CGGGCAGGGCAGGGCGCGGGAGG + Intergenic
948503567 2:238411825-238411847 CGGGGAAGGCAGGATCGGGGGGG + Intergenic
948990556 2:241551850-241551872 TGGGCAGGGCAGGAAGTGGGCGG - Intergenic
949027655 2:241773997-241774019 GGGGCGAGGCAGGAGCCAGGAGG - Intergenic
1168771564 20:419818-419840 GGGGCAAGGCAGTAACGGAGAGG - Intronic
1168965172 20:1894521-1894543 CGGGCCCGGCAGGGACGGGGAGG + Intronic
1172842725 20:37911720-37911742 CCAGCAAGGCAGGCACAGGGTGG - Intronic
1175172065 20:57087664-57087686 CAGGCAAGACAGGAATCAGGAGG + Intergenic
1175437645 20:58965580-58965602 CAGGGAAGGCAGGAGCTGGGTGG - Intergenic
1175921012 20:62450715-62450737 AGGGCCAGGCAGGCACCAGGTGG + Intergenic
1175972286 20:62692693-62692715 CCGGGCAGGCAGGAACAGGGTGG + Intergenic
1176069380 20:63218110-63218132 CCGGCAATGCAGGACCCTGGAGG + Intergenic
1176858420 21:13987800-13987822 AGGGCAGGGCAGGGACAGGGTGG - Intergenic
1179522187 21:41953058-41953080 CAGGCAAGGCAGGTACTGGCTGG + Intronic
1180702556 22:17789551-17789573 AGGGTGAGGCAGGCACCGGGTGG + Exonic
1185088791 22:48754802-48754824 TGGGCAGTGCAGGACCCGGGCGG - Intronic
954677462 3:52323743-52323765 AGGGACAGGCAGGACCCGGGAGG - Intronic
956768591 3:72505494-72505516 AGGGCATGGCAGGGACAGGGTGG + Intergenic
962613906 3:137104944-137104966 CTGACAAGGCAGCAACTGGGGGG + Intergenic
968086625 3:195876805-195876827 CGGGCAAGGCGGGCAGTGGGAGG - Intronic
968266713 3:197368544-197368566 CCTGCAAGGCAGGAAGGGGGAGG + Intergenic
968942935 4:3648521-3648543 CGGGCATGGCAGGAAGGGGCAGG - Intergenic
972725767 4:41745748-41745770 CGGGCGAGCCAGGGCCCGGGCGG - Exonic
982897122 4:160945495-160945517 CTGCCAAGGCAGGAGCTGGGGGG + Intergenic
989310869 5:40016363-40016385 GGGGAATGGCATGAACCGGGAGG + Intergenic
993463720 5:88218549-88218571 AGGCCAAGGCAGGAACCTGGAGG + Intronic
993744606 5:91581458-91581480 AGGGCAAGGAAGGAAAGGGGAGG - Intergenic
997362548 5:133304436-133304458 AGGGAGAGGCAGGAACGGGGTGG - Intronic
999237757 5:150109177-150109199 CGGGGAAGGTAGGAGCAGGGAGG + Intronic
1001056979 5:168457770-168457792 CAGCCATGGCAGGAACCTGGTGG - Intronic
1002720767 5:181260285-181260307 GGGGCAAGGAAGGAGGCGGGTGG + Exonic
1003033587 6:2623623-2623645 CCGACAAGGCCGGACCCGGGAGG + Exonic
1003147249 6:3518717-3518739 CGGGCATGGGAGGAGCAGGGAGG + Intergenic
1003703083 6:8492596-8492618 TGGGCAAGACAGGAAATGGGGGG + Intergenic
1007747498 6:44051901-44051923 CGGGCAAGGAGGGAGCTGGGAGG - Intergenic
1012172858 6:96041073-96041095 GGGGAAAGGCATAAACCGGGAGG - Intronic
1015130729 6:129806038-129806060 CTGTCAAGGGAGGAACCTGGTGG + Intergenic
1015936522 6:138410224-138410246 CTGGCAAGGCAGGCACGTGGGGG + Intronic
1016801057 6:148169358-148169380 AAGGCAAAGCAGAAACCGGGAGG - Intergenic
1018814049 6:167317737-167317759 GGTGCAAGGCAGGAAAGGGGAGG - Intergenic
1020212882 7:6168870-6168892 TGGGCAACGCAGGAACCAGAAGG + Intronic
1021541591 7:21765392-21765414 GGGGCAAGGCAGAAACAGGCGGG - Intronic
1022447123 7:30479743-30479765 TGGGCAAGGCGGGGGCCGGGGGG - Intergenic
1024024166 7:45397388-45397410 AGGCCTAGGCAGGACCCGGGAGG - Intergenic
1024979384 7:55144784-55144806 GGGGCCAGGCAGGAACCCAGAGG - Intronic
1026843496 7:73683905-73683927 CGGGAAGGGAAGGACCCGGGTGG + Intronic
1026884655 7:73932894-73932916 GGGGCAGGGCAGGAAACTGGAGG - Intergenic
1027267373 7:76501756-76501778 CGGACAGGGCAGGATCCTGGGGG - Intronic
1027319186 7:77001621-77001643 CGGACAGGGCAGGATCCTGGGGG - Intergenic
1029489935 7:100865684-100865706 CGGGGAAGGCAGGAACAGACAGG - Intronic
1030820179 7:114084972-114084994 CGGGCAGGGGAGGGACCGGAGGG + Intergenic
1031836909 7:126690270-126690292 AGGGCAAGGCAGGCACGGAGTGG + Intronic
1036773170 8:11592653-11592675 CGGGCGAGGCAGCATCCTGGAGG - Intergenic
1037142957 8:15540136-15540158 CGGGAAAGGCAAGCTCCGGGCGG + Intronic
1039414180 8:37379447-37379469 TGGGCAAGGTAGGAAGGGGGTGG - Intergenic
1041673601 8:60516815-60516837 CGGGCAAGGCAGGCGCGGGGCGG + Intergenic
1043737577 8:83767753-83767775 AGGGCAAGCCAGGCACAGGGTGG + Intergenic
1044759970 8:95507456-95507478 AGGGGAAGGCAGGAACCAGATGG + Intergenic
1049007766 8:139866468-139866490 AGGGGAAGGCAGGAACCTGTGGG + Intronic
1050085100 9:1957141-1957163 CTGGGAAGGCAGGAAGCGGAAGG - Intergenic
1050913227 9:11100832-11100854 CATGCAATGGAGGAACCGGGTGG - Intergenic
1054870695 9:70044858-70044880 TGGCCGAGGCAGGAACGGGGCGG + Intronic
1060198326 9:121637397-121637419 CGAGCAAGGCAGGAACCCATCGG - Intronic
1061248814 9:129414777-129414799 CGGGCGAGGCGGGAGCCGGTGGG + Intergenic
1061296077 9:129677501-129677523 CTCTCCAGGCAGGAACCGGGAGG - Intronic
1061763699 9:132868434-132868456 GTGGCAAGGCAGGAACGTGGAGG - Intronic
1061948295 9:133920908-133920930 AGGGCCAGCCAGGAAGCGGGTGG - Intronic
1061991177 9:134159489-134159511 CGGCCCAGGGAGGAAGCGGGGGG + Exonic
1062655934 9:137604797-137604819 CGGGGAAGGCAGGGGGCGGGGGG + Intergenic
1062665295 9:137667537-137667559 TGGGGAAAGCAGGACCCGGGAGG + Intronic
1186500549 X:10047233-10047255 TGAGCAAGGCAGGAACAAGGGGG - Intronic
1189499459 X:41542308-41542330 AGGGCCAGGCAGGAGCCAGGCGG + Intronic
1190243746 X:48677044-48677066 AGGGCAAGGTAGGGACTGGGAGG + Intronic
1191975694 X:66868728-66868750 AGGGCAAGGCAGGGAGGGGGAGG - Intergenic
1193918620 X:87399058-87399080 TGGGCATGGGAGGAACCTGGTGG + Intergenic
1201077189 Y:10196961-10196983 CGTGCAAGGCCGGCACGGGGCGG - Intergenic