ID: 1077905652

View in Genome Browser
Species Human (GRCh38)
Location 11:6530785-6530807
Sequence TGATTGTTTTGTCTTCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 1, 2: 5, 3: 45, 4: 428}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077905641_1077905652 30 Left 1077905641 11:6530732-6530754 CCTCCTCTTGTACAGGGGGTTCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1077905652 11:6530785-6530807 TGATTGTTTTGTCTTCTCTCTGG 0: 1
1: 1
2: 5
3: 45
4: 428
1077905651_1077905652 -10 Left 1077905651 11:6530772-6530794 CCGGGAGGACGTTTGATTGTTTT 0: 1
1: 0
2: 0
3: 12
4: 127
Right 1077905652 11:6530785-6530807 TGATTGTTTTGTCTTCTCTCTGG 0: 1
1: 1
2: 5
3: 45
4: 428
1077905643_1077905652 27 Left 1077905643 11:6530735-6530757 CCTCTTGTACAGGGGGTTCAGGC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1077905652 11:6530785-6530807 TGATTGTTTTGTCTTCTCTCTGG 0: 1
1: 1
2: 5
3: 45
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077905652 Original CRISPR TGATTGTTTTGTCTTCTCTC TGG Intronic
901886528 1:12227402-12227424 TGATTGTTTTTTTTTGTTTCTGG + Intergenic
902024397 1:13371924-13371946 TGATAAGTTTGTCTTTTCTCTGG - Intergenic
902822811 1:18953924-18953946 TGATTGTGTTGTCATGCCTCAGG - Intronic
906575851 1:46888780-46888802 TGTTTGTTTTGACTTCTGTGTGG + Intergenic
906596122 1:47079114-47079136 TGTTTGTTTTGACTTCTGTGTGG - Intronic
906653177 1:47527955-47527977 TGAATGTTTTGTCTCCTGACGGG - Intergenic
906814369 1:48862887-48862909 TTCTTGTTTTGACTTCTGTCTGG - Intronic
906830712 1:49028332-49028354 TGATTGTTCTGTTTTCTCTAGGG - Intronic
907567223 1:55446657-55446679 TCATTGTTTTATCATCTCACAGG - Intergenic
908401640 1:63776854-63776876 TGAATGTTTGATCTTTTCTCTGG + Intronic
908561352 1:65309715-65309737 TGATTATTTTCTCTTTTCTCCGG + Exonic
908644930 1:66266988-66267010 TGGTTGTTGTGTTTTCTTTCTGG + Intronic
908690735 1:66776696-66776718 TGATTATTTTCTCTTCACTAAGG + Intronic
909512185 1:76465930-76465952 TGGTTGTTTTATTTTCTGTCAGG - Intronic
911793226 1:102045315-102045337 TGCTTGTTTTTTCTTCTCTGAGG - Intergenic
912345135 1:108956771-108956793 TACTTGCTGTGTCTTCTCTCTGG - Intronic
912737329 1:112161342-112161364 TGATTGTTTCCTCTTGTCCCTGG - Intergenic
913086948 1:115447660-115447682 TGGTTGTTTCCTCTTCTTTCAGG + Intergenic
914820291 1:151096717-151096739 TGCTTGTTATATATTCTCTCAGG + Intronic
915694393 1:157724224-157724246 TGACGTTTTTGTCATCTCTCAGG + Intergenic
915771009 1:158423697-158423719 TGATTTTTCTGTATTTTCTCAGG + Intergenic
917810654 1:178655122-178655144 TGAGTGTCCTGTATTCTCTCTGG - Intergenic
919230515 1:194766886-194766908 TGATTGTTTTGTTTTATTTTAGG + Intergenic
919400773 1:197113701-197113723 TGTGTGTTGTGTCTTCTCCCAGG - Intronic
919992110 1:202715173-202715195 TGATTGTTTTTCCTTCTCAAAGG + Intergenic
920268067 1:204741497-204741519 GTTTTGTTTTGTTTTCTCTCTGG + Intergenic
920429980 1:205912427-205912449 TCTTTGTTTTGTCTAATCTCTGG + Intergenic
920436641 1:205951121-205951143 TGCTTGTTTTGTCTCCTTTGCGG + Intergenic
920528114 1:206683768-206683790 TGGGGGTGTTGTCTTCTCTCTGG + Intronic
921105561 1:211973677-211973699 TGATTGTACTGTATACTCTCAGG - Intronic
922013648 1:221620324-221620346 TGTTTTATTTGTCTTCCCTCAGG + Intergenic
922642000 1:227243492-227243514 TGACTGTTTTGTGTTTTCTGAGG - Intronic
923732773 1:236569124-236569146 TGATAGTTGTGTTTTCTTTCAGG - Exonic
924482296 1:244447783-244447805 TAATTGTTTTAACATCTCTCTGG - Intronic
924896952 1:248349361-248349383 TGATTGTTGTCTCTGCTCTGGGG + Exonic
1062839619 10:659981-660003 AGATTATTTTTTCCTCTCTCTGG - Intronic
1065224630 10:23531273-23531295 TAAAGGTTTTGTCTGCTCTCAGG - Intergenic
1065801439 10:29356597-29356619 TGGTGGGATTGTCTTCTCTCAGG - Intergenic
1066000266 10:31098263-31098285 TTTTTGTTTTGTTTTCTCCCAGG - Intergenic
1066167535 10:32803446-32803468 TAATTGTTATATCCTCTCTCTGG + Intronic
1067273651 10:44815162-44815184 TGATTGTTTTCTCTGTTCTCTGG + Intergenic
1067571387 10:47373884-47373906 AGAATGTTTGGTGTTCTCTCAGG - Intronic
1068593224 10:58872195-58872217 TGTTTGTTTGTTTTTCTCTCAGG - Intergenic
1069125445 10:64627061-64627083 TTATTGATTTGTTTTCCCTCAGG + Intergenic
1070478752 10:76857761-76857783 TGAGTGTTCTCTCTTCTTTCTGG - Intergenic
1070598369 10:77848623-77848645 TGCTTGTTTTGTTGTCTGTCAGG - Intronic
1071075202 10:81742047-81742069 TTACTTTTTTGTCTTCTTTCAGG - Intergenic
1071116901 10:82232527-82232549 TCATTTTGCTGTCTTCTCTCAGG + Intronic
1071904881 10:90161867-90161889 AGAATGTTTTGTCTTCTGTGGGG - Intergenic
1072018591 10:91375805-91375827 GAATTGTTTTCTCTTCTTTCTGG + Intergenic
1073200717 10:101732962-101732984 TTTTTGTTTTTTTTTCTCTCAGG + Intergenic
1073262120 10:102198383-102198405 TAATTCTTCTTTCTTCTCTCTGG + Intergenic
1073454893 10:103630439-103630461 TGATTAGTCTGTCATCTCTCTGG + Intronic
1073974939 10:109089943-109089965 TCATTCCTTTGTCTTCCCTCCGG + Intergenic
1075280941 10:121137748-121137770 AGAGTTCTTTGTCTTCTCTCTGG - Intergenic
1076388181 10:130074392-130074414 TGATTGTGTTTTCTTCTCTCAGG + Intergenic
1077854828 11:6113299-6113321 TGACTGTTATTCCTTCTCTCTGG - Intergenic
1077905652 11:6530785-6530807 TGATTGTTTTGTCTTCTCTCTGG + Intronic
1078178461 11:8988921-8988943 TGATTCTTGTGTGTTCGCTCAGG - Intronic
1079277954 11:19059247-19059269 TTCTTTTTTTCTCTTCTCTCTGG + Intronic
1081460560 11:43268990-43269012 GGATTGCTTTATCTGCTCTCTGG - Intergenic
1082734747 11:56843974-56843996 TGTTAGTTTTGTGTTCACTCTGG - Intergenic
1082899508 11:58230148-58230170 TCATTGTCTTTTCTTATCTCAGG - Intergenic
1083374152 11:62206010-62206032 TGAATGCATTGTTTTCTCTCTGG - Intergenic
1085521242 11:77140140-77140162 TGGTTATTTTATCTTCTCCCAGG + Intronic
1085933623 11:81117574-81117596 TTATTTTTTGGTCTTCTCTTTGG + Intergenic
1086703154 11:89922659-89922681 CAATTGTTTTGTCTATTCTCAGG - Intergenic
1086782135 11:90920717-90920739 TGATTTTTTTTTCTTTTCCCAGG + Intergenic
1087077034 11:94134919-94134941 TGATAGTTTTGTCTTCAACCAGG - Intronic
1087347963 11:96995167-96995189 TCCTTGGTTTGTTTTCTCTCAGG + Intergenic
1087351415 11:97037700-97037722 TGATTATTTTTTGTACTCTCTGG - Intergenic
1088376434 11:109146507-109146529 CAATTCTCTTGTCTTCTCTCCGG - Intergenic
1088381299 11:109195609-109195631 TGTTTGTTTTAACTTCTCTGTGG + Intergenic
1088452314 11:109995219-109995241 TGCTTGCTTTTTCCTCTCTCTGG - Intergenic
1089056459 11:115589480-115589502 TGATGGTTTTCTGTTTTCTCAGG + Intergenic
1090098295 11:123766534-123766556 TAATTTGTTTTTCTTCTCTCAGG + Intergenic
1090133808 11:124173724-124173746 TGAATGTCATGTCTTCCCTCAGG - Intergenic
1090134001 11:124176743-124176765 TCATTCTTTTGTCCTCTCACAGG - Intergenic
1090448609 11:126786344-126786366 TGATTCTTTTTTCTTTTCTTTGG + Intronic
1090475140 11:127013520-127013542 TGATTTTCTTGTGTTCTCCCAGG - Intergenic
1091075369 11:132610874-132610896 TGATTGTTCTGTCTTTCCTATGG + Intronic
1091188425 11:133668324-133668346 TAATTGTTTTGTATTCTTTTTGG - Intergenic
1091828007 12:3529289-3529311 TCATTTATTTGTCATCTCTCAGG + Intronic
1092299242 12:7229496-7229518 TGACTGTTTTGTCTTCTCCCAGG - Intergenic
1093541252 12:20288026-20288048 GACTTGTTTGGTCTTCTCTCTGG - Intergenic
1094109904 12:26851253-26851275 TGATTCCTTTCACTTCTCTCAGG - Intergenic
1094289292 12:28828439-28828461 TCATTCATTTGCCTTCTCTCAGG - Intergenic
1094335728 12:29350068-29350090 TAATTGTTTTTTCTCCTTTCAGG - Exonic
1095508433 12:42923480-42923502 TTTTTGTTTTGACTTCTTTCTGG + Intergenic
1095677766 12:44939281-44939303 TGATAGTTTTGATTTCTCTTAGG - Intergenic
1097100975 12:56589101-56589123 TGTTTGTCTTGTCTCCTCTCTGG + Intronic
1097564891 12:61254499-61254521 TAAATGTCTTGCCTTCTCTCTGG - Intergenic
1097584597 12:61500119-61500141 TGCTTGTTCTGTCTTCTCCTGGG + Intergenic
1099201917 12:79688890-79688912 AGATTGTTTTGTCTTGTTTCTGG + Intronic
1099767563 12:87007402-87007424 TGTTTATTTTGTCTCCTCTCAGG + Intergenic
1099855825 12:88164450-88164472 TTATTTGTTTTTCTTCTCTCAGG + Intronic
1100785859 12:98077141-98077163 TGTTTGTTTTATCTTCTGGCTGG - Intergenic
1101056990 12:100927847-100927869 TGATTGTGTTGTATTCCATCAGG + Intronic
1101267456 12:103104334-103104356 TGTTTGTTCAGTCTTCACTCTGG - Intergenic
1101590865 12:106124131-106124153 TTTTTGTTTTGTTTTCTCTGCGG + Intronic
1101632255 12:106506413-106506435 TGACTGTTTTCTTTTTTCTCCGG - Intronic
1102680911 12:114689911-114689933 TGAAGGTTTTTTCCTCTCTCAGG + Intergenic
1102843985 12:116158016-116158038 TAATTGTTTTGTTTTTACTCCGG - Intronic
1103128116 12:118442334-118442356 TGTTTATTTTTTCTTCTCTTAGG - Intergenic
1104112993 12:125721731-125721753 TGGCAGCTTTGTCTTCTCTCTGG - Intergenic
1104159795 12:126167367-126167389 TAAAACTTTTGTCTTCTCTCTGG + Intergenic
1104192101 12:126491767-126491789 TGATTTCTCTCTCTTCTCTCTGG + Intergenic
1104657727 12:130586127-130586149 TCATAGCTTTGTCTTCCCTCAGG + Intronic
1105836666 13:24217996-24218018 TGCGAGTTTTGTCTGCTCTCAGG - Intronic
1106682871 13:32026045-32026067 TGATTCCTTTGTCTTGGCTCTGG + Intergenic
1106860152 13:33896999-33897021 TAATTTTTTTGTTTTCTTTCAGG - Intronic
1106975446 13:35206467-35206489 TGATGGTTTTGTTTTCTTGCTGG + Intronic
1107037666 13:35917970-35917992 TATTTGTTTTCTCTTCTGTCTGG - Intronic
1107223375 13:38014625-38014647 TGATTGTTTTCTTTGCTCTCCGG + Intergenic
1108013329 13:46046070-46046092 AGATTGTTTTGACTTCTGTCAGG - Intronic
1108448381 13:50532765-50532787 TTATAGTCTTTTCTTCTCTCAGG - Intronic
1109183367 13:59241382-59241404 TGATTTTTTTCTTTTGTCTCAGG - Intergenic
1110323915 13:74192119-74192141 TGATTGGTTCTTCTGCTCTCTGG - Intergenic
1110363900 13:74659951-74659973 TTATTATTTTTTCTTCTTTCTGG - Intergenic
1110373681 13:74767614-74767636 TTATTGATTTGTTTTCTCTTAGG - Intergenic
1110422346 13:75326787-75326809 TGATCTTTTTTTCATCTCTCTGG - Intronic
1110493346 13:76135594-76135616 TGATTGTTCTTTTTTCTCTCAGG + Intergenic
1110880159 13:80561691-80561713 TAATTTTTTTGTTTTCTCACAGG - Intergenic
1111108607 13:83677016-83677038 TTATTTTCTTCTCTTCTCTCAGG - Intergenic
1111443125 13:88306390-88306412 TTATTGTTTTGTCTTTTTTATGG + Intergenic
1112425219 13:99292077-99292099 TGATTGAGTTGTCTTCTTTATGG + Intronic
1113110355 13:106815987-106816009 TTATTATTTTGTCTCCTCACAGG - Intergenic
1113321057 13:109232596-109232618 TCATTGATTTCTCTTCTCCCTGG + Intergenic
1114530399 14:23391872-23391894 GTATTGTTTTGTCTTCTCAATGG - Intronic
1114653609 14:24302597-24302619 GATTTGTTTTGACTTCTCTCAGG + Intronic
1114678111 14:24459109-24459131 AGATTTTTGTGACTTCTCTCAGG + Intergenic
1116321238 14:43466284-43466306 TTGTTGTTTTTTATTCTCTCAGG + Intergenic
1116605498 14:46988147-46988169 GTATTTTTTTTTCTTCTCTCTGG + Intronic
1116953720 14:50901873-50901895 AGATTATTTTGTCTTTTCTCAGG - Exonic
1118134391 14:63005803-63005825 TGATTGTTGTGACCTTTCTCTGG - Intronic
1118527186 14:66659623-66659645 GGATTGTTTTGTCTTCCCGATGG + Intronic
1119299303 14:73558691-73558713 TTAATGATTTCTCTTCTCTCTGG - Intronic
1119411239 14:74432052-74432074 TGAGTGTTTCCCCTTCTCTCTGG - Intergenic
1119785358 14:77309533-77309555 TGATGGTTCTGTGTTCTGTCTGG - Intronic
1120266431 14:82256962-82256984 TGATTGTTCTGTGATCTCACTGG + Intergenic
1120599277 14:86480947-86480969 TGTTTGTTTTGTGTTTTGTCTGG + Intergenic
1120599278 14:86480976-86480998 TGTTTGTTTTGCCTTCTATGTGG + Intergenic
1120791384 14:88586787-88586809 TGATTATTTTCTCATCTATCAGG - Intronic
1121509932 14:94505056-94505078 TGAATGTTTTTTCTGCTCACTGG - Intronic
1122685388 14:103502327-103502349 TCATTGTTTTTCCTCCTCTCTGG - Intronic
1123456209 15:20428250-20428272 TGTTTGTTTTGTATGCTTTCCGG + Intergenic
1123635358 15:22302587-22302609 TGTTTGTTTTGTATGCTTTCCGG - Intergenic
1124799787 15:32821174-32821196 AGATTGTCTTGTCCTCTCTCAGG + Intronic
1124884340 15:33670945-33670967 TTATTATTTTATTTTCTCTCTGG - Intronic
1125030655 15:35072611-35072633 TGACTGTGTTTTCTTTTCTCTGG + Intergenic
1125259038 15:37801283-37801305 TGCTCATTTTCTCTTCTCTCAGG - Intergenic
1125353541 15:38792414-38792436 TGCCTGTATTCTCTTCTCTCTGG + Intergenic
1126114351 15:45195521-45195543 TCCTGGTTTTCTCTTCTCTCAGG + Intronic
1126297180 15:47153117-47153139 AGGTTGTTCTGTGTTCTCTCTGG - Intergenic
1127636189 15:60872406-60872428 CTATTGTTTGGTCTTCACTCTGG + Intronic
1127949540 15:63791143-63791165 TGATAGATATGTCATCTCTCAGG - Intronic
1132720700 16:1314271-1314293 TGGTTGTTTTCTTTTCTCTCAGG + Exonic
1132902707 16:2267244-2267266 TAATTGTTCTCTCCTCTCTCTGG - Exonic
1133426926 16:5700356-5700378 TCTTTGTATTGCCTTCTCTCTGG + Intergenic
1133858378 16:9571212-9571234 TGAGGGTTTTGTCTGCTTTCTGG + Intergenic
1136667108 16:31821449-31821471 TGAAGGTTTTGCCTTCTCTTAGG + Intergenic
1138442810 16:57045469-57045491 TGCTTGTCTTGTCCCCTCTCAGG - Exonic
1139028917 16:62855276-62855298 GGATTGTTTTATCTGCTCTATGG - Intergenic
1139047027 16:63074147-63074169 TGATTTTTTTTTGTTCTGTCTGG + Intergenic
1141047689 16:80731148-80731170 CAATTGTTTTCTCTTGTCTCTGG - Intronic
1143999497 17:11039693-11039715 TGCTTGTTTTGTGTGATCTCTGG + Intergenic
1144318371 17:14087359-14087381 GGATAGTGTTGTCTTCTTTCCGG - Intronic
1145477125 17:23627097-23627119 TGGATGTTTTGTCCTCTCTGAGG + Intergenic
1145557788 17:24800495-24800517 TGAATATTTTGTCCTCTCTGAGG + Intergenic
1149189156 17:54037722-54037744 TTATTGGTTTTTCTTCTTTCTGG + Intergenic
1149294114 17:55245515-55245537 TGATAGTTTTATCTTCTTTGGGG - Intergenic
1150694310 17:67391139-67391161 TGATTTTTTTTTCTTTGCTCAGG - Intronic
1152314629 17:79572942-79572964 TAATTGTTTTGTCTTCTCTCTGG - Intergenic
1203159297 17_GL000205v2_random:34409-34431 TGATTGTTTGTTCTTCACTTAGG - Intergenic
1154174587 18:12076965-12076987 TCATTGTATTGTCTTATCTTGGG - Intergenic
1154287415 18:13072864-13072886 TTCTTGTTATGTCTTCTGTCTGG + Intronic
1155052063 18:22157239-22157261 TGATTTTTTTTTCTTCACTCAGG + Intergenic
1155274921 18:24177483-24177505 TTGTTGCTTTGTCTTCTGTCCGG + Intronic
1155705033 18:28799310-28799332 GGAATATTTTGTCTACTCTCTGG + Intergenic
1155817816 18:30336434-30336456 TTATTTTTTTCTCTTCACTCAGG - Intergenic
1156301740 18:35842240-35842262 TAATTGTTTTGTCATCTTTTGGG - Intergenic
1156814050 18:41287336-41287358 TTATTATTTTTTCCTCTCTCAGG - Intergenic
1158072479 18:53489460-53489482 TGTTTGTTTAGTGTTCTCTAAGG - Intronic
1158883193 18:61800711-61800733 TGTTTGTTAGGTCTTCTCACTGG + Intergenic
1159164010 18:64680285-64680307 TTATTTTTTTGTATCCTCTCAGG - Intergenic
1159278760 18:66256252-66256274 TGATGCTGTTGTTTTCTCTCTGG - Intergenic
1159404470 18:67982317-67982339 TAATGGATTTGACTTCTCTCTGG - Intergenic
1159951716 18:74488933-74488955 TCATTGTTTTCTCTCCTTTCTGG - Intergenic
1160290379 18:77587987-77588009 AGATTGGTGTGTCTTCTTTCTGG - Intergenic
1160374185 18:78398595-78398617 TGATTCTGTTGGCTTCTCTCTGG + Intergenic
1161759357 19:6159902-6159924 TGTCTGTTTCTTCTTCTCTCTGG + Intronic
1161923988 19:7287498-7287520 AGATTTTTTTTTTTTCTCTCAGG - Intronic
1163238731 19:16045464-16045486 TAAGTGTTGAGTCTTCTCTCAGG - Intergenic
1164220599 19:23190124-23190146 TGATTCTTTTGTCTGGTTTCGGG - Intergenic
1164928225 19:32148481-32148503 TGATTGTTTTGTCTTCCTGGTGG - Intergenic
1165107438 19:33480337-33480359 TAATTGTTTTATCTTCTTTGTGG - Intronic
1166256656 19:41610845-41610867 TGATTCTTTTGTCATCTGTCTGG + Intronic
1167602087 19:50460155-50460177 TGGTTTTTTTGTCTGCTTTCTGG - Exonic
925491379 2:4398603-4398625 TGATTGTTATGTCTTCTTATTGG + Intergenic
925938851 2:8795335-8795357 CTACTGTTTTGTCTTCTCACAGG - Intronic
926779801 2:16459787-16459809 TCATTTGTTTCTCTTCTCTCAGG + Intergenic
926856846 2:17265973-17265995 TTACTGTTCTGTCTTCTCTAGGG + Intergenic
927614885 2:24583089-24583111 TGATTGTTTTCTCTGCTGTGAGG - Intronic
929200890 2:39234508-39234530 TCATTGTTTTGTCTTCTTCAGGG - Intergenic
930263563 2:49174252-49174274 TGATGAGTTTGTCTTCTCACAGG + Intergenic
930629985 2:53742641-53742663 TGATTGTTTTTGCTTTTCCCAGG - Intronic
931774690 2:65530490-65530512 TTATTTTTTTTTCCTCTCTCTGG + Intergenic
932372995 2:71208487-71208509 TGATTGTCTTCTCAACTCTCTGG - Intronic
932429766 2:71667348-71667370 CAACTTTTTTGTCTTCTCTCTGG + Intronic
932921749 2:75923825-75923847 TGATTGTTGTGGCTTCTCTGAGG + Intergenic
932931938 2:76051271-76051293 TGAGTTTTTTCACTTCTCTCTGG + Intergenic
933561861 2:83897593-83897615 TGATTTCTTTGTATTTTCTCTGG - Intergenic
933563869 2:83924983-83925005 TGAGTCTTTTCTCTTCCCTCAGG - Intergenic
933728831 2:85441982-85442004 TTATTGTTTTGTCTGCTCACCGG + Intergenic
934739409 2:96708801-96708823 TAATTGCTTGATCTTCTCTCTGG - Intronic
935073953 2:99722376-99722398 TGATTGTTTTTTGTTCTATCAGG + Intronic
935143063 2:100372006-100372028 TGATTGTTTTTTTTTTTTTCTGG - Intergenic
935372176 2:102357935-102357957 TGGTTGTTTTATCATCTCACAGG + Intronic
936115547 2:109699914-109699936 TGGTTTGTTTCTCTTCTCTCAGG + Intergenic
936238028 2:110762044-110762066 GGATTGTTATGTCTTCTTTGTGG + Intronic
936620835 2:114095801-114095823 TAATTATTTTGTCTTCTTTATGG + Intergenic
936633780 2:114233278-114233300 TGTTTGTTTTCACCTCTCTCAGG + Intergenic
936953142 2:117998318-117998340 TGTTTGTTTTGTTTTCCCCCCGG - Intronic
941083637 2:161091244-161091266 TGAGTGTTATGTCCTCTCTCTGG - Intergenic
941163352 2:162059712-162059734 TAATTGTTTTTTCTTATATCGGG - Intronic
941739729 2:169021456-169021478 TAATTGATTTGTCTTCTAGCTGG - Intronic
942315203 2:174691436-174691458 AGATTGTTTTGTATTCTTTTAGG + Intergenic
942675838 2:178426285-178426307 TGATTGTTTTGTTTTCTGTCGGG + Intergenic
943097412 2:183447108-183447130 TGTTTGTGTTGTCTTCTATCAGG + Intergenic
943378868 2:187118087-187118109 TGTTTCTTTTTTCATCTCTCTGG + Intergenic
944197886 2:197074299-197074321 TGATTGTTTTCTCTCCTCAGAGG - Intronic
944202630 2:197123930-197123952 TCATTGTTTTGTGTGCTGTCAGG - Intronic
945187537 2:207154925-207154947 TCATTGGTCTGTCTTCTTTCTGG - Intronic
945543930 2:211125248-211125270 TTTATGTTTTGGCTTCTCTCTGG + Intergenic
945658043 2:212649734-212649756 TGATTGTTATGACTTCTATGTGG + Intergenic
946345206 2:219104070-219104092 TGTTTGTTTTGTTTTGTCTCAGG + Intronic
946611096 2:221458840-221458862 TGAATGCTTTCTCTTCTCCCTGG - Intronic
948024837 2:234768699-234768721 TGAGTGTGTTGTCTTGTCTCAGG - Intergenic
948369283 2:237477444-237477466 GGATTGTTTGGTCTTCTCAGGGG + Intergenic
1168844160 20:931960-931982 TGTTTAATTTGGCTTCTCTCTGG - Intergenic
1169081344 20:2799376-2799398 CCATTGTTGTGTCTGCTCTCTGG + Intronic
1169306045 20:4491403-4491425 TGGCTTTTTTGTCTTCTCTATGG - Intergenic
1169326558 20:4681490-4681512 TGTTTGTATGGTCTTCTCTTAGG - Intergenic
1170140528 20:13121510-13121532 TGATTGTTTTCTCTACACACAGG - Intronic
1170258345 20:14372855-14372877 TGTTTGCTGTGTCTTCTTTCTGG + Intronic
1170397223 20:15939806-15939828 TGATATTTTGGCCTTCTCTCAGG - Intronic
1171561512 20:26130950-26130972 TGTTTGTTTTGCCTACTCTCAGG - Intergenic
1171794125 20:29553204-29553226 TCTTTGTTTTGTCTTCTCTTAGG - Intergenic
1172322889 20:34010535-34010557 TGATTCTTTTGCCTACTTTCAGG - Intronic
1173180157 20:40800218-40800240 TGATTTTTTTCTCCTCTGTCTGG + Intergenic
1173638800 20:44584597-44584619 TGTTTGTTTTGTTTTCTTTAAGG + Intronic
1174907576 20:54567992-54568014 TGATTGTTTTGTCATATCATAGG - Intronic
1175062065 20:56252472-56252494 TGATTTTTATGACATCTCTCTGG - Intergenic
1175361939 20:58418910-58418932 TGATGGTTTTCTCTTCTGTCTGG + Intronic
1176951324 21:15050711-15050733 TGATGGTTTTGACTCCTTTCTGG + Intronic
1177285813 21:19048199-19048221 TGTTTGTTATTTTTTCTCTCTGG - Intergenic
1178251337 21:31006259-31006281 TGTTTCTTTTGTCTCCTCTGGGG + Intergenic
1181819438 22:25463976-25463998 TGTTTGTTTTGTTTTACCTCCGG - Intergenic
1181900511 22:26151651-26151673 TGAATGTTTTCACTTCTCTTAGG - Intergenic
1182383690 22:29916530-29916552 TAATTTGCTTGTCTTCTCTCAGG + Intronic
1182452870 22:30431609-30431631 TGATGGTTTTATCTCCTCACGGG - Intergenic
1183004040 22:34885435-34885457 TGTTTTTTTTTTTTTCTCTCTGG + Intergenic
1184930225 22:47675424-47675446 TGATACTCTTGTCTTCTCTCAGG - Intergenic
949598583 3:5574491-5574513 TGTTTGTTTGGTCTTATTTCTGG + Intergenic
950427236 3:12931087-12931109 TGATTCTCCTGCCTTCTCTCTGG - Intronic
951543782 3:23806479-23806501 TCATTGTTATGTCTTCGCTGCGG + Intronic
952137465 3:30439492-30439514 TTTTTGTTTTTTCTTTTCTCTGG + Intergenic
953941159 3:47098943-47098965 TGCTTGTATTGTCCTCTCTGAGG - Intronic
956075197 3:65497759-65497781 TGATTATTTTGAATCCTCTCAGG - Intronic
956652472 3:71517650-71517672 AGAGTGTTTTCTCTTCTCTCTGG - Intronic
957151209 3:76488355-76488377 TGATGTTCTTGTTTTCTCTCTGG + Intronic
957607148 3:82415896-82415918 TTTTTCTTTTGTCTTCTGTCAGG - Intergenic
958216065 3:90578786-90578808 TGAATGTTTTGTCTTTTTTGAGG - Intergenic
958220312 3:90663875-90663897 TGATTATTTTGTCCTCTTTGTGG - Intergenic
958544836 3:95531880-95531902 TGATTCTTTTTTCTTGTATCAGG + Intergenic
958595229 3:96214014-96214036 TCATTGATTTCTCTTCTCTTTGG + Intergenic
958602271 3:96311817-96311839 GTGTTGTTTTGTTTTCTCTCTGG + Intergenic
958794602 3:98693399-98693421 TGAGTGTTTCCTGTTCTCTCAGG - Intergenic
959398065 3:105867089-105867111 TGTTTGTTCTGTCTTCTGTGAGG - Intronic
960090770 3:113636002-113636024 TGCTTTTTTTGTCTTATTTCTGG - Intergenic
960446595 3:117757031-117757053 TTATAGATTTGTCTTCTCTGAGG + Intergenic
960600581 3:119454051-119454073 TGATTGCTTTTTCTTCTGTCTGG - Intronic
962084581 3:132176914-132176936 TGTTTGTTTTCTCCTTTCTCAGG - Intronic
962915554 3:139900089-139900111 TGATTGATTCTTCTTTTCTCAGG + Intergenic
963362557 3:144293914-144293936 TCATTCTTTTTTCTTCTCTCAGG + Intergenic
964312288 3:155407410-155407432 TTTTTTCTTTGTCTTCTCTCTGG + Intronic
964340350 3:155702367-155702389 TCACTGTTTTTTCTTCTTTCAGG - Intronic
965270118 3:166604634-166604656 GGATTTTTTGGTCTTCTCTAAGG + Intergenic
965340566 3:167485790-167485812 TGCTTATTTTCTCTCCTCTCAGG - Intronic
965351432 3:167616413-167616435 TTATTTGTTTCTCTTCTCTCAGG - Intronic
966440327 3:179937854-179937876 TGATAATGTTGTCTCCTCTCTGG + Intronic
966899201 3:184468126-184468148 AGGTTGTTTAGTCTTCTCCCTGG - Intronic
967191281 3:186987050-186987072 TGATTGTTCTGTTTTCCCCCAGG - Intronic
967704642 3:192635621-192635643 TGATTGTTTTCTCTGGTTTCTGG - Intronic
968389502 4:177735-177757 TCATTGTTTTGTCCTTTGTCAGG - Intergenic
968955892 4:3719147-3719169 TGAATGTATGGTCTTCTCTCAGG + Intergenic
970001470 4:11369441-11369463 TAATTGTTCTCTCCTCTCTCTGG + Intergenic
970103975 4:12559318-12559340 TAATTGTTTTTTATTCTCTAGGG - Intergenic
970833909 4:20377268-20377290 TGAATGTATTATATTCTCTCAGG + Intronic
971982965 4:33778679-33778701 TAATTGTTCTTTCTTTTCTCAGG + Intergenic
972125444 4:35759293-35759315 TGATTATTTTCTTTTCTCTTTGG - Intergenic
972187476 4:36548566-36548588 TGTTAGTTATGTCTTCTCTTAGG + Intergenic
972710106 4:41587236-41587258 TGATAGTTTTGTCTGCCCTAGGG + Intronic
974220406 4:58962128-58962150 TGATTGTTTTATGCTCTCGCAGG - Intergenic
976849497 4:89528991-89529013 TGATAGTTCTTTCTTCTTTCAGG + Intergenic
977574840 4:98664836-98664858 TGATTCTTCTGCCTTCCCTCTGG + Intergenic
977860729 4:101956789-101956811 TGTTTGTTTTTTCTCCTCTTAGG + Intronic
978114283 4:105001202-105001224 TGATTATTTTGTCTGCTGGCTGG - Intergenic
978618839 4:110620511-110620533 TGGTTTATTTATCTTCTCTCAGG - Intronic
979593173 4:122504217-122504239 TGATTGCTTTGTCTCATCTATGG - Intergenic
979659319 4:123235651-123235673 TGATTTATTTGACATCTCTCAGG - Intronic
979722981 4:123924771-123924793 TGCTTGTTTTCTTTTCTTTCTGG + Intergenic
979736867 4:124097533-124097555 TGATTATTTTCTCTGCTTTCTGG + Intergenic
980586334 4:134821117-134821139 TAATTGTTTTGTTTTCCCCCCGG - Intergenic
980683175 4:136190139-136190161 GGATAGTTTTGTCTATTCTCAGG - Intergenic
980701351 4:136435580-136435602 TGATTTTTTTTTATTCTCTGGGG + Intergenic
981137208 4:141224053-141224075 TTATTATTTTGTATTCTCTTTGG + Intronic
981643424 4:146971069-146971091 TGATTTTTTTTTTTCCTCTCAGG + Intergenic
981898141 4:149829117-149829139 TCATTGTTTTCTCTTACCTCTGG + Intergenic
982937938 4:161508993-161509015 TCATTATATTGTCTTCTCTCTGG - Intronic
983298729 4:165899107-165899129 TGATTCTTCTGTCTTTTGTCTGG + Intronic
983639567 4:169932519-169932541 TGTTTGTTGTGTCTTCCCCCTGG + Intergenic
984137858 4:175963433-175963455 TCATTATTTTTACTTCTCTCTGG - Intronic
984496724 4:180507304-180507326 TCTTTGTTTTGGCATCTCTCAGG - Intergenic
984505131 4:180608177-180608199 TGATTATTTAGTATTTTCTCAGG - Intergenic
984940568 4:184928663-184928685 TCATTTATTTCTCTTCTCTCAGG + Intergenic
985391936 4:189499074-189499096 TTATTGTTATGTCTAATCTCTGG - Intergenic
986411706 5:7487828-7487850 TGATTTCTTTGTTTTCTTTCAGG + Intronic
986900519 5:12425747-12425769 TAATTGGTATGTCTTCTCTTAGG - Intergenic
987253521 5:16124532-16124554 TGATGGTTCTGTCTTCTCCTGGG - Intronic
987495277 5:18635164-18635186 TGAGTGTCTTGTATTTTCTCTGG + Intergenic
988543281 5:32132152-32132174 TGTTTGTTTTGTTTTGTCTTTGG - Intronic
989012626 5:36890921-36890943 TGATTCCTATGTCTTTTCTCAGG + Intronic
989018868 5:36975862-36975884 TGCTTCTTTTGTTTTCTTTCTGG - Exonic
989746237 5:44833717-44833739 TTATTGTATTGTCTCCTCACTGG - Intergenic
990210055 5:53472832-53472854 TGATTGTTGTGTCATCTGGCTGG + Intergenic
990596839 5:57320767-57320789 TTACTGTTTTGTCTAATCTCTGG + Intergenic
991258185 5:64638200-64638222 TCTTTGTCTTGTCTTCTCTGAGG - Intergenic
991299159 5:65112231-65112253 TAGTTGTTTTGACCTCTCTCAGG - Intergenic
991523431 5:67528220-67528242 TGATTGGTTGGGCTTATCTCAGG - Intergenic
992725321 5:79601199-79601221 TGATTGTGTTGTCTATTCTCAGG + Intergenic
993038606 5:82786232-82786254 TCATTCTTTTGGTTTCTCTCTGG + Intergenic
993745768 5:91595015-91595037 TGTTTGTTTTGTTTTCTTTTTGG + Intergenic
994271688 5:97784696-97784718 TATTTGTTTTGTTTTCTCCCAGG - Intergenic
994758088 5:103819180-103819202 TGATTCCTTTCACTTCTCTCTGG - Intergenic
994904877 5:105826751-105826773 TGAATATTCTTTCTTCTCTCTGG + Intergenic
995086199 5:108112599-108112621 TGATTGTTTTTTCTCCTCATGGG - Intronic
995708415 5:115009879-115009901 CAATTGTCTTGTCTTCTCACAGG + Intergenic
998390596 5:141784829-141784851 TGTTTGTTTTCTTTCCTCTCTGG - Intergenic
998859449 5:146428376-146428398 GGATTATTTTGTCTTCTGTGTGG + Intergenic
1000095196 5:157965661-157965683 TGATTTTTTTTTCTTTTCTGTGG + Intergenic
1000380840 5:160628054-160628076 TGATGGTTTTGTCCTGTCTAAGG + Intronic
1000449410 5:161366534-161366556 TGAGTGTTATTTCTGCTCTCAGG - Intronic
1000713935 5:164616514-164616536 GGACTGTTCTTTCTTCTCTCAGG - Intergenic
1000718167 5:164672966-164672988 TGCTTGTTTTGGCTCCTCTAAGG + Intergenic
1001616803 5:173049312-173049334 TGGGTTTTTTGTCTCCTCTCTGG - Intergenic
1001995164 5:176151550-176151572 GGATTGTTTTGCCTTCTGTGTGG - Intergenic
1003174069 6:3741991-3742013 TGATTGTTTTATATTCACTAAGG + Intronic
1004199221 6:13532493-13532515 TGGTTGTTTTGTCTTCCACCTGG + Intergenic
1004443653 6:15677450-15677472 AGCTGGTTTTGTCATCTCTCTGG - Intergenic
1004855008 6:19740659-19740681 TGATTTTTTTCTCTTCTGTCAGG - Intergenic
1005382051 6:25245624-25245646 TTATTGGTTTCTCTTTTCTCCGG + Intergenic
1005632795 6:27724504-27724526 TCATTTATTTCTCTTCTCTCAGG - Intergenic
1007540163 6:42634962-42634984 TTATTGTTTTGCCTTCTTTCAGG + Intronic
1008147491 6:47909207-47909229 TGTTTGATGTGTATTCTCTCTGG - Intronic
1008286291 6:49655227-49655249 TGACTGGTTTGTCATCTCCCAGG + Intergenic
1008293817 6:49753054-49753076 TGATTGTTTTGTATTTGCTGAGG + Intergenic
1009191674 6:60636572-60636594 TCATTTTTATGTCTTCTCTGGGG + Intergenic
1009215819 6:60918871-60918893 CCATTGTTGTGTCTTATCTCTGG + Intergenic
1010377615 6:75190390-75190412 TGCTTGTTTTTACTTCTATCAGG - Intronic
1010505526 6:76653785-76653807 TGATTGTTTTTGCTTGTGTCAGG - Intergenic
1011526910 6:88275753-88275775 TGTTTGTTTTGGCTTGACTCAGG - Intergenic
1012726515 6:102819048-102819070 TGCTTGTTCTTTCTTCTCTTTGG + Intergenic
1013432328 6:110066240-110066262 TCATTTATTTCTCTTCTCTCAGG - Intergenic
1013730515 6:113159313-113159335 TGATTATTTTTTCTTCCCTCAGG - Intergenic
1013944140 6:115702895-115702917 TGATTGTTTTGAATTTTATCAGG + Intergenic
1014654453 6:124082489-124082511 TGATTGTTTTGTTTTCCCTATGG + Intronic
1014903634 6:127000547-127000569 TGATTGTGTTGTCATCACTGTGG - Intergenic
1015228689 6:130887873-130887895 TGACTGATTTGTCTTCTTTGGGG + Intronic
1016210318 6:141524390-141524412 GGATTGTTTTGTCTAATATCAGG - Intergenic
1016675638 6:146764142-146764164 TGATTGTTTTGTTTTATGTTAGG - Intronic
1016715457 6:147222582-147222604 GGAGTGATTTTTCTTCTCTCAGG + Intronic
1017739029 6:157388937-157388959 ACCTTGCTTTGTCTTCTCTCAGG + Intronic
1018277481 6:162148418-162148440 TGATAGTTTAGTTTTCTCACTGG - Intronic
1019780609 7:2937619-2937641 TAAATGTTGTGTGTTCTCTCGGG - Intronic
1020584028 7:10043363-10043385 TGATTATTTTGTCTGCTGTATGG - Intergenic
1021636109 7:22695478-22695500 TTGTTGTTTTATTTTCTCTCTGG + Intergenic
1021783607 7:24130701-24130723 TGTTTGATTTATCTTATCTCTGG + Intergenic
1022141569 7:27497477-27497499 TGAATTTGTTGTCTTCTCACAGG - Intergenic
1022190824 7:28015671-28015693 ACACTGTTTTGTCTTTTCTCCGG + Intronic
1022564339 7:31382486-31382508 TTATTATTTTGTCCTCACTCTGG - Intergenic
1024166856 7:46742599-46742621 GTTTTGTTTTGTTTTCTCTCAGG - Intronic
1024354794 7:48403407-48403429 TGCTTGCATTGTCTCCTCTCTGG - Intronic
1024458953 7:49639814-49639836 TATTTGTTTGGTCTTGTCTCTGG + Intergenic
1025754216 7:64319996-64320018 TGTTTGTTTAGTCTTCTCTCTGG - Intronic
1026070358 7:67113390-67113412 TTGTTGTTTTGGCTTCTCTTAGG + Intronic
1026646313 7:72172452-72172474 TCATTGTTTTGTCTGCTTTTTGG - Intronic
1026706547 7:72698878-72698900 TTGTTGTTTTGGCTTCTCTTAGG - Intronic
1028023019 7:85801868-85801890 TGATTATATTTTCTTTTCTCGGG + Intergenic
1028642050 7:93053499-93053521 TGTTTGATTTGTCTTCTCAATGG + Intergenic
1028948039 7:96602899-96602921 TGATTTATTTGCCTTCTCTCTGG - Intronic
1030017304 7:105236699-105236721 CTCTTGTCTTGTCTTCTCTCTGG - Intronic
1030269876 7:107660110-107660132 TCAGTGTTTTGTCTTCTGTTGGG - Intergenic
1030750090 7:113221599-113221621 TGATTTTTTGCTTTTCTCTCAGG - Intergenic
1031262909 7:119545564-119545586 TCATTGTTTTGCCTCCTTTCTGG + Intergenic
1031461414 7:122053879-122053901 TGCTGTTTTTGTCTTCTCTTTGG + Intronic
1032341726 7:131080059-131080081 TGTTTGTTTTCGCTTCTCTGAGG - Intergenic
1034092226 7:148374194-148374216 GGATTTTTTTTTCTTCTCTTGGG + Intronic
1035010152 7:155708399-155708421 TGATTATTTTGGCCTCTTTCGGG + Intronic
1035158263 7:156931964-156931986 TGCTTATTTTGTCTTCTTCCTGG - Intergenic
1036192795 8:6686309-6686331 TGATTGTTTTCTTGTTTCTCTGG + Intergenic
1037122560 8:15306342-15306364 TGATTGTTTTGGCTGCTTTGTGG - Intergenic
1038130063 8:24720162-24720184 TGATTTGTTTTTCTTCTCTCAGG - Intergenic
1038471683 8:27828928-27828950 TCATTTGTTTCTCTTCTCTCAGG - Intronic
1039017637 8:33169964-33169986 TTATTGATTTGTCCTCTCTTAGG + Intergenic
1039800146 8:40947227-40947249 TCATTTTTTTCTCTTCTCTATGG - Intergenic
1040357813 8:46636710-46636732 TGACTTTCTTGCCTTCTCTCTGG + Intergenic
1040382053 8:46882520-46882542 TGACTTTCTTGCCTTCTCTCTGG - Intergenic
1040850527 8:51897373-51897395 TGCTTTTTTTTTCTTGTCTCAGG + Intronic
1041283592 8:56236937-56236959 TGATTCTTTTGCTGTCTCTCTGG + Intergenic
1042680114 8:71374159-71374181 TGATTGTTTTATCTGCTGTGCGG - Intergenic
1043315058 8:78910214-78910236 TAATTGTTTCTTCTTCTCTCTGG - Intergenic
1043562920 8:81515872-81515894 TCATTCATTTTTCTTCTCTCTGG + Intergenic
1043957043 8:86372502-86372524 CTATTGTTTTGTGTCCTCTCAGG - Intronic
1044049007 8:87475971-87475993 AGAGTGTTTTGTTTTCTCTGTGG - Intronic
1045690563 8:104755793-104755815 TGGTTTTTGTGTCTTATCTCGGG + Intronic
1046089141 8:109478359-109478381 TGCTTGTTTTGTCATCTCTTTGG - Intronic
1046097261 8:109576646-109576668 TGCTTATTCTGTCTCCTCTCAGG + Intronic
1046218169 8:111177265-111177287 TGATTGTGATGTTTTCTCTCAGG + Intergenic
1046789178 8:118302800-118302822 TGATTTCTTGGACTTCTCTCTGG - Intronic
1048951467 8:139500365-139500387 TGACTGTTTAGTCCTCCCTCAGG + Intergenic
1049069663 8:140346720-140346742 TTTTTGTTTTGTTTTCTCTTTGG - Intronic
1051512149 9:17889953-17889975 TGCTTGTTTTTTCTTTTGTCTGG + Intergenic
1051587759 9:18745286-18745308 AGGTAGTTTTCTCTTCTCTCTGG + Intronic
1052423975 9:28279737-28279759 TGTTTGTATTGTATTCTCCCAGG + Intronic
1053483313 9:38432629-38432651 TGACTGTGCTGTCCTCTCTCTGG - Intergenic
1054093899 9:60880566-60880588 TGATTATTTTGTCTTTTTTTAGG + Intergenic
1055126406 9:72723080-72723102 TCATTGTTTTTCCTTCTCACAGG - Intronic
1055488432 9:76780297-76780319 TGATATTTTTCACTTCTCTCTGG - Intronic
1055535112 9:77233356-77233378 TGATTTTTTTTCATTCTCTCTGG + Intronic
1055759235 9:79589146-79589168 TAATAGTATTTTCTTCTCTCTGG - Intronic
1055871589 9:80886996-80887018 AGATTATTTCCTCTTCTCTCAGG - Intergenic
1056080652 9:83091156-83091178 TGAGTGTTTGGTTTTTTCTCAGG + Intergenic
1056975643 9:91250676-91250698 TCATTATGTTTTCTTCTCTCTGG + Intronic
1057028300 9:91753977-91753999 TGATTGTTTTGTATTTCCTTAGG + Intronic
1057754501 9:97821280-97821302 TGATTGGTTTGTCTGTTTTCTGG - Intergenic
1057944215 9:99310530-99310552 TGACTGTTTGGAATTCTCTCAGG + Intergenic
1058203677 9:102074718-102074740 TGATTGGGTTGTTTTCTCTGAGG - Intergenic
1058415833 9:104787808-104787830 TGATTGGCTTGTCTTCCCCCAGG - Intronic
1058616050 9:106828894-106828916 AGATTGTTTTGTATTTTCTTAGG + Intergenic
1059900985 9:118925083-118925105 TGATTTTGTTGTCTTCTCCATGG - Intergenic
1060008843 9:120025565-120025587 TCTTTGTTTTGTCATCTTTCTGG - Intergenic
1061471375 9:130828776-130828798 TTATTTTTTTGTTTTCTTTCTGG - Intronic
1185784380 X:2877454-2877476 TGATTCTTCTGTCTTCTCTCTGG + Intronic
1186308014 X:8285624-8285646 ACATTGTTTTATCTTCTCACAGG - Intergenic
1186351622 X:8745691-8745713 TGTTTGTTTTGTATTCTTTCTGG + Intergenic
1187481878 X:19664128-19664150 TGACTGTTCTGTGGTCTCTCTGG - Intronic
1188771038 X:34154812-34154834 TGTTTGTTTTGTCTGCTTTGTGG + Intergenic
1188796788 X:34476807-34476829 TGCTTGTTTTGTCTGCTTTGTGG + Intergenic
1191791206 X:64974644-64974666 TGAAAGTTTGGCCTTCTCTCTGG + Intronic
1192711400 X:73594003-73594025 TGATTTTTTTTTCTGCTCTGGGG + Intronic
1192815460 X:74586067-74586089 TGCCTGTTTTATCTTCTCCCAGG - Exonic
1193704564 X:84805507-84805529 TGGTTGTTTTTTCTTCTGTGGGG - Intergenic
1193989397 X:88287069-88287091 CGTTATTTTTGTCTTCTCTCTGG - Intergenic
1194078294 X:89425643-89425665 TGCTTTTTTTTTCTTCACTCTGG + Intergenic
1194172370 X:90602912-90602934 TGCTTTTTTTCCCTTCTCTCAGG - Intergenic
1194762628 X:97812467-97812489 TTATTGTTTTGATTTTTCTCAGG - Intergenic
1194845850 X:98808375-98808397 TGATTCTTTTCTCCTCTATCTGG - Intergenic
1195800937 X:108709396-108709418 TAATTGTTATGTCTTCTTTATGG + Intergenic
1196335798 X:114532244-114532266 TGAGTGTTCTGTTTTGTCTCCGG + Intergenic
1197461882 X:126752779-126752801 TGTTTGTTTTATTTTCTCTAGGG - Intergenic
1197953767 X:131924266-131924288 TGATTGTTGTGTCTCTTCTGGGG - Intergenic
1199582797 X:149377167-149377189 TTGTTGTTTTGTCTTCTCTTTGG - Intergenic
1200518595 Y:4180649-4180671 TGCTTTTTTTCCCTTCTCTCAGG - Intergenic
1200848785 Y:7860776-7860798 TGAATTTCTTGCCTTCTCTCTGG - Intergenic
1200859001 Y:7970088-7970110 TGACTTTCTTGCCTTCTCTCTGG - Intergenic
1200896792 Y:8384361-8384383 TGATTTTCTTGCCTTCTCTCTGG - Intergenic
1202262998 Y:22989215-22989237 AGATTTTCTTCTCTTCTCTCTGG + Intronic
1202415988 Y:24622956-24622978 AGATTTTCTTCTCTTCTCTCTGG + Intronic
1202454799 Y:25047130-25047152 AGATTTTCTTCTCTTCTCTCTGG - Intronic