ID: 1077907518

View in Genome Browser
Species Human (GRCh38)
Location 11:6545793-6545815
Sequence TAGTCTTAAGACTCTGTAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077907518_1077907525 18 Left 1077907518 11:6545793-6545815 CCCCCTACAGAGTCTTAAGACTA 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1077907525 11:6545834-6545856 CTCTGTCACCAGCGGCATGCTGG 0: 1
1: 0
2: 0
3: 8
4: 146
1077907518_1077907522 10 Left 1077907518 11:6545793-6545815 CCCCCTACAGAGTCTTAAGACTA 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1077907522 11:6545826-6545848 TGAACCCTCTCTGTCACCAGCGG 0: 1
1: 0
2: 0
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077907518 Original CRISPR TAGTCTTAAGACTCTGTAGG GGG (reversed) Exonic
904546835 1:31281129-31281151 AAGTGTGAAGTCTCTGTAGGGGG - Intronic
911764909 1:101662281-101662303 TAGTCTTAGGACTCTTAATGAGG + Intergenic
912915447 1:113810639-113810661 TAGCCTTAAGACTCAATACGTGG + Intronic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
1066972681 10:42327947-42327969 TAGGCTTAAGAGTCTTTTGGAGG + Intergenic
1072840000 10:98762085-98762107 TAGCCATAAAACTCTGTAAGTGG - Intronic
1075820341 10:125302501-125302523 TTGTCTTAAGACCCTTTGGGAGG + Intergenic
1077907518 11:6545793-6545815 TAGTCTTAAGACTCTGTAGGGGG - Exonic
1078680885 11:13474543-13474565 AAGTCTTTAGACTCACTAGGAGG + Intergenic
1089190173 11:116647999-116648021 AAGTCTTACGATTCTCTAGGAGG + Intergenic
1089904072 11:122019881-122019903 AAGTCTTAAGACAATGTAGCAGG + Intergenic
1091085510 11:132718395-132718417 AAGTCTTAAAACACTGTAGGGGG + Intronic
1093212478 12:16324703-16324725 TGGTTTTATGACTCTGGAGGAGG - Intergenic
1093361753 12:18237784-18237806 CAGTCTTCAGACTCTGGTGGAGG + Intronic
1097309812 12:58105997-58106019 TAGCTTTAAAACTCTCTAGGAGG + Intergenic
1097664480 12:62464011-62464033 TAGGCTTCAGACTCTGAAGTTGG - Intergenic
1100584928 12:95970685-95970707 AAGTCTTGAGACAGTGTAGGGGG + Intergenic
1103605518 12:122083121-122083143 AAGTGTTCAGAATCTGTAGGTGG - Intronic
1107663102 13:42659766-42659788 TAGCTTGAAGACTTTGTAGGAGG - Intergenic
1109666207 13:65541729-65541751 TAGTTTTAAGACTATGTATGTGG + Intergenic
1113573350 13:111374518-111374540 TTTTCTTAACACTCTGTTGGTGG - Intergenic
1119924995 14:78485068-78485090 TAGCCTTGAGACTCTGCAGTGGG - Intronic
1120080844 14:80214436-80214458 TAGAATTAGGACTCTGTTGGGGG + Intronic
1126028633 15:44474116-44474138 GAGTCTTAACATTCTGTGGGTGG - Intronic
1127109570 15:55653307-55653329 TTGTCTTAAGACCCTATGGGGGG - Intronic
1128196626 15:65763073-65763095 TACTCTTAAGACTTTGTCGGTGG - Intronic
1128834271 15:70796632-70796654 TACTCTGAAGCCTTTGTAGGGGG + Intergenic
1135265518 16:21022266-21022288 CAGTCTTAGGACCCTGAAGGAGG - Intronic
1140499636 16:75422693-75422715 CAGTTTTAAGACTCTCTAAGAGG - Intronic
1141451809 16:84108674-84108696 GACTCTTAAGACCCTGTAGTGGG - Intronic
1141800652 16:86306375-86306397 TAGTGTTCAGGCTCTGTGGGCGG + Intergenic
1141818591 16:86429954-86429976 TAGTCGTAACCCTCTGTAGCTGG - Intergenic
1147037060 17:37689541-37689563 TTGTGTTTAGACTCTGAAGGAGG - Intronic
1151959212 17:77396630-77396652 CAGTCTTAGGACTCTGATGGGGG + Intronic
1158968170 18:62642037-62642059 TATTCATAAGGCTCTGTAGCGGG + Intergenic
1164803548 19:31098229-31098251 TAGTCGTCAAACTCTATAGGTGG + Intergenic
1164953586 19:32361576-32361598 GAGTCTTAAAACTCTGTGGAAGG + Intronic
927993317 2:27463790-27463812 TAGTGTTAAGGCTCTATAGCAGG + Intronic
930947388 2:57091946-57091968 TTGTATTAAGAATATGTAGGCGG - Intergenic
941712269 2:168726583-168726605 TGGTCTTCAGACACTGTGGGAGG - Intronic
946151526 2:217775969-217775991 TAATCTTAAAAATCTGTAGAGGG - Intergenic
946727862 2:222679322-222679344 TAGTCTTCAAACTTTGTTGGTGG + Intronic
947035099 2:225844004-225844026 TAGCCCTAAGACCTTGTAGGTGG - Intergenic
947768022 2:232649812-232649834 TAGTCTCCAGACTCTGTTAGGGG - Intronic
948096418 2:235337780-235337802 CCGTCTTAAGCCTCTGGAGGAGG + Intergenic
1178803628 21:35819891-35819913 TAGTGTTAAGACTGTGTAGCAGG + Intronic
1182818153 22:33187613-33187635 TAGTCTTAAGAATCACTAAGAGG + Intronic
1184724385 22:46335256-46335278 CAGACTTAAGACTGTCTAGGCGG - Intronic
950796329 3:15513386-15513408 TAGACACAAGACTCTGTAGTGGG - Intronic
951851205 3:27142186-27142208 TAGTCTGAAAACTGTGAAGGTGG - Intronic
962088422 3:132217148-132217170 TAGTCCTCAACCTCTGTAGGTGG + Intronic
964776409 3:160283333-160283355 AAGTCTTCAGACATTGTAGGAGG - Intronic
965252977 3:166366911-166366933 TACTCTTATGACTCTGTTGATGG - Intergenic
965739284 3:171856595-171856617 TAGTCCTATGATTCTGTGGGAGG - Intronic
974333889 4:60514927-60514949 TAGTTTTAAGACTCAATTGGAGG + Intergenic
977382562 4:96294928-96294950 TATTCTTAAATATCTGTAGGTGG + Intergenic
977712378 4:100142317-100142339 TAGTATTGAGGCACTGTAGGAGG - Intergenic
981489286 4:145322604-145322626 TAGACACAAGACTGTGTAGGGGG + Intergenic
993056892 5:82991569-82991591 TAGTCTTAAGAATTTTTAGAGGG + Intergenic
993198808 5:84785308-84785330 TATACTTAAGACTTTGTAAGTGG + Intergenic
995251524 5:109998649-109998671 TAGCCTTAAATCTCTATAGGTGG + Intergenic
997402485 5:133613026-133613048 ATGTCTTAAGATTCTGTAGTTGG - Intergenic
997859811 5:137406128-137406150 TAGTGGTGAGCCTCTGTAGGAGG - Intronic
998987574 5:147777991-147778013 TACTTTTAAGAATGTGTAGGTGG + Intronic
999522206 5:152362327-152362349 TAGTTTGAAGACTATGTAGCTGG - Intergenic
1000987343 5:167875303-167875325 AAGTGTGAAGACTCTGAAGGTGG + Intronic
1001361755 5:171092858-171092880 TAGTCCTTAAACTCTGTAGTCGG + Intronic
1005677447 6:28169518-28169540 TATTCTGAAGACTTTGAAGGAGG + Intergenic
1007146824 6:39643216-39643238 AAGTCTTAACACTGTGTAGATGG + Intronic
1014215139 6:118745799-118745821 TATTGTTATGACTTTGTAGGGGG - Intergenic
1031134205 7:117868236-117868258 TAGTCTTGATTATCTGTAGGTGG + Intronic
1032436525 7:131905512-131905534 AAGTATCAACACTCTGTAGGAGG - Intergenic
1039443038 8:37608644-37608666 TAGTCCTAGGACTCAGTGGGAGG - Intergenic
1041032215 8:53748583-53748605 TATTTTTAAAACTCTGTAGATGG + Intronic
1046293275 8:112190092-112190114 AAGTATTAAGAATCTGGAGGAGG + Intergenic
1051546954 9:18287192-18287214 GAGCTTTAAGACTTTGTAGGTGG - Intergenic
1052134700 9:24895220-24895242 TAGTCATAAGATTCTGTTGTTGG + Intergenic
1057751220 9:97794823-97794845 TAGTCTTAAGAGTCTCTTAGGGG + Intergenic
1188371112 X:29370676-29370698 TATTCTTAATAATTTGTAGGAGG - Intronic
1188894504 X:35650529-35650551 TAGTCTTATAACTTTGTTGGTGG - Intergenic
1189080649 X:37968487-37968509 TAGTCCTATGATTCTGTGGGAGG + Intronic
1191705982 X:64095008-64095030 TAGTCTTTAGACTCCTTAAGAGG - Intergenic
1193709232 X:84859270-84859292 CAGTCCTATGATTCTGTAGGAGG + Intergenic
1193710307 X:84871141-84871163 CAGTCCTATGATTCTGTAGGAGG - Intergenic
1193838816 X:86382745-86382767 TGGTGTTGAAACTCTGTAGGAGG - Intronic
1195377657 X:104243614-104243636 TAGTCTTAAAACTCTGCTTGAGG - Intergenic
1197536927 X:127701664-127701686 TAGCCTTTAGATTCTGTAGAGGG - Intergenic
1198457682 X:136833153-136833175 TAATCTTAAGAATCTGTAAAGGG - Intergenic