ID: 1077907833

View in Genome Browser
Species Human (GRCh38)
Location 11:6547534-6547556
Sequence AGCTCTCTGCTGCAGGTACA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 216}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077907827_1077907833 13 Left 1077907827 11:6547498-6547520 CCTGCAACATTGCGATTCCTCAC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1077907833 11:6547534-6547556 AGCTCTCTGCTGCAGGTACACGG 0: 1
1: 0
2: 1
3: 14
4: 216
1077907829_1077907833 -4 Left 1077907829 11:6547515-6547537 CCTCACCTGCCAAGGTGTCAGCT 0: 1
1: 0
2: 0
3: 22
4: 234
Right 1077907833 11:6547534-6547556 AGCTCTCTGCTGCAGGTACACGG 0: 1
1: 0
2: 1
3: 14
4: 216
1077907830_1077907833 -9 Left 1077907830 11:6547520-6547542 CCTGCCAAGGTGTCAGCTCTCTG 0: 1
1: 0
2: 1
3: 23
4: 317
Right 1077907833 11:6547534-6547556 AGCTCTCTGCTGCAGGTACACGG 0: 1
1: 0
2: 1
3: 14
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077907833 Original CRISPR AGCTCTCTGCTGCAGGTACA CGG Exonic
901973922 1:12929634-12929656 AGCTGTCTGCCTCAGGAACACGG - Intronic
902011258 1:13272134-13272156 AGCTGTCTGCCTCAGGAACACGG + Intergenic
905442319 1:38003549-38003571 AGATCTCTCATGCAGGTCCACGG + Intronic
906499379 1:46330223-46330245 AGCTCTCTGCATCATGAACAAGG - Intergenic
907271140 1:53291910-53291932 GTCTCTGTGCTGCAGGGACAGGG - Intronic
907936805 1:59048948-59048970 AGCACTATTCTGCAGGCACAGGG + Intergenic
908743824 1:67356204-67356226 ATCTCTCTGCAGCAGCTTCAGGG - Intronic
912223058 1:107699639-107699661 AGCGGTCTGCTGCAGGGTCAGGG - Intronic
913397549 1:118388832-118388854 AGCTCTCTGTTCCAGGCCCATGG + Intergenic
913597986 1:120396021-120396043 AGGTCTCAGCTGCAGGTCCTGGG - Intergenic
914089343 1:144483299-144483321 AGGTCTCAGCTGCAGGTCCTGGG + Intergenic
914309268 1:146450916-146450938 AGGTCTCAGCTGCAGGTCCTGGG - Intergenic
914512416 1:148345641-148345663 AGGTCTCAGCTGCAGGTCCTGGG + Intergenic
914592843 1:149122221-149122243 AGGTCTCAGCTGCAGGTCCTGGG + Intergenic
915665598 1:157441468-157441490 AGCTCCCTGCAGCAGATGCAGGG + Intergenic
916724477 1:167510496-167510518 AGCTGCCTGCTGCAGGGAGAAGG - Intronic
917001755 1:170368218-170368240 AGCTCTCAGATGCAGGGAAATGG - Intergenic
917986841 1:180328864-180328886 AGCTTTCAGCTGCAGGTTCTAGG + Intronic
918969640 1:191397645-191397667 AGCTGTGTGCAGCAGGTACCTGG + Intergenic
919799760 1:201346500-201346522 AGCTCCCTGCCACTGGTACAGGG - Intergenic
920265758 1:204721462-204721484 ACCTCACTGCTGCAGGTACGGGG - Intergenic
920427645 1:205890919-205890941 AGCTATCTGCAGCAGGAGCATGG - Intergenic
921781625 1:219172266-219172288 AACTCTCTGCTGCAGATCTATGG + Intergenic
921841609 1:219834716-219834738 AGCTCTCTCCTGCAGAGAGAGGG - Intronic
923147298 1:231207106-231207128 AGCTCTTTGCTGCACCCACATGG + Intronic
1064305544 10:14162739-14162761 AGCTGGTTGCTGCAGGTACCAGG + Intronic
1064321676 10:14310849-14310871 AGCTCTCTCCTGCAGAGAGAGGG - Intronic
1064803099 10:19098801-19098823 AGCTCTCTCCTGCAGAGAGAGGG + Intronic
1068175242 10:53448561-53448583 AGCTCTCTCCTGCAGGGAGAGGG + Intergenic
1069893580 10:71666769-71666791 AGGACTCTGCTGCAGGAACCCGG - Intronic
1070506829 10:77120786-77120808 TGCTCTCTTCTGCAGGGCCAGGG - Intronic
1070607304 10:77907999-77908021 AGGTGGCTGCTGCAGGTTCATGG - Intronic
1070685266 10:78475885-78475907 AGCCCACTGCTGCTGGTCCATGG + Intergenic
1070711590 10:78687000-78687022 AGCCCCATCCTGCAGGTACACGG + Intergenic
1071458640 10:85870669-85870691 AGCTCCCTGTTCCAGGTAGAGGG + Intronic
1072725931 10:97814009-97814031 CGCTTTCTTCTGCAGGTAGAAGG + Intergenic
1074883542 10:117677152-117677174 AGTTCTCTGCTGTAGGGAAAGGG + Intergenic
1075344565 10:121672785-121672807 AGCTCACTGCTGCAGGTTGCAGG + Intergenic
1075675479 10:124293079-124293101 AGCTCCCTGCGGCAGGAACCTGG - Intergenic
1076433181 10:130421935-130421957 AACTGTCTGCTCCAGGTGCAAGG + Intergenic
1076937163 10:133574008-133574030 AGCTCTGTGATGCTGGGACAGGG - Intergenic
1077907833 11:6547534-6547556 AGCTCTCTGCTGCAGGTACACGG + Exonic
1079580416 11:22056289-22056311 AGCTCTGTGCTGCAGGCCTAAGG + Intergenic
1079634598 11:22720332-22720354 AGCTCACTGCTTGAGGCACAGGG + Intronic
1081751431 11:45513923-45513945 AGCTTTCTCCTGCAGGCACTGGG + Intergenic
1086279668 11:85171442-85171464 AGCTCTCTGCTTCGGATCCAAGG - Intronic
1087893275 11:103559386-103559408 AGCTCTTAGCTTCAGATACATGG + Intergenic
1088952528 11:114586190-114586212 AGCTCTCTTCTGTAGAGACAGGG - Intronic
1088976599 11:114821805-114821827 AGCTCTAGGCTGCAGGTGCCAGG - Intergenic
1089982425 11:122783281-122783303 AGCTCGCTGCTGCAGGGAGATGG + Intronic
1097096069 12:56549521-56549543 AAGTTTCTGCTACAGGTACAGGG + Intronic
1097446040 12:59672662-59672684 AACTCTCTTCTGCAAGCACATGG - Intronic
1098218133 12:68241140-68241162 AGCTCTCTGCTGCAGTCACAAGG - Intergenic
1098289466 12:68943924-68943946 TTCTTTCTGCTACAGGTACAGGG - Intronic
1099663970 12:85602150-85602172 ATCTCTCTGCTAAAGGTCCAGGG + Intergenic
1102245941 12:111355786-111355808 TGCTCTCAGCTCCAGGCACAGGG + Intergenic
1102251304 12:111389411-111389433 TCCTCTCTGCTGCAGCCACATGG - Intergenic
1103877913 12:124142969-124142991 AGCTCTCTGCTGCAGACAGCAGG - Intronic
1104256682 12:127145934-127145956 AGGTCCCTGCTGCAGGTGCGTGG - Intergenic
1104330061 12:127836386-127836408 AGCTCTCTCCTGCAGAGAGAGGG + Intergenic
1105431396 13:20340579-20340601 AGGTCTCTGCTGCTCTTACAGGG - Intergenic
1106004713 13:25757890-25757912 AGCTCTATTCTGAAGGCACAGGG + Intronic
1108000896 13:45904827-45904849 GGCTCTCATCTGCAGGTGCAGGG - Intergenic
1108713558 13:53057341-53057363 AGCTCTCTCCTGCAGAGAGAGGG + Intergenic
1108741353 13:53342340-53342362 AACACTCTGCTCCAGCTACACGG - Intergenic
1111576934 13:90166924-90166946 TCCTCTCTGTTGCAGTTACATGG - Intergenic
1112829870 13:103436435-103436457 GGATCTCCGCTGCAGGCACATGG - Intergenic
1114872947 14:26679552-26679574 TGCTCTCTGCTGCAGGAATATGG - Intergenic
1120051515 14:79872368-79872390 AGTTCTGTGCTGCTGGTCCATGG + Intergenic
1128034050 15:64507547-64507569 AGCCTTCTGGTGCAGGAACAAGG + Intronic
1128818469 15:70631092-70631114 TGCCCACTGCTGCAGGGACAGGG + Intergenic
1128964063 15:72039990-72040012 AGATTGCTGCTGCAGGTTCAGGG - Intronic
1129172898 15:73818595-73818617 TGCTCTCTGCAGCAGCTGCAGGG - Intergenic
1131829268 15:96343976-96343998 TGCTTTCTGCTGCAGGAACCTGG + Intergenic
1132130611 15:99275202-99275224 TTCTCTCTGCTGGAGGTACTGGG - Intronic
1132644362 16:991969-991991 AGCTCTCTGCTGCTGCTGGAAGG + Intergenic
1133124607 16:3637927-3637949 AGTTCTCTGATGCAGCTAAAAGG + Intronic
1133870383 16:9680360-9680382 AGCTCTCTCCTGCAGAGAGAGGG - Intergenic
1134885419 16:17786614-17786636 GGCTTTCTGCTGCATGTATATGG + Intergenic
1135221505 16:20618210-20618232 AGCTCTCTGCTGCAGATCTGTGG + Intronic
1139936207 16:70572916-70572938 AGCTCACTTCTCCAGGTTCAAGG - Exonic
1140520116 16:75573726-75573748 AGATCTCTGCAGAAGGTACAAGG + Intronic
1141807866 16:86353943-86353965 AGCTCCCTCCTGCAGGGAAATGG + Intergenic
1142117645 16:88368333-88368355 AGTTCTCTGCTGCCGGCTCAGGG - Intergenic
1142374443 16:89699992-89700014 AGCTCAGTGCTGCAGGCACTGGG - Intronic
1142537734 17:631414-631436 ATCCTTCTGCTGCAGGTTCAGGG - Intronic
1146056396 17:29583475-29583497 CCCACGCTGCTGCAGGTACAGGG - Exonic
1146658202 17:34647753-34647775 AGCTCCCTGCTGCAGGGCCCAGG - Intergenic
1147238980 17:39078041-39078063 GGCTCTCTCCTGCAGGCAGAGGG - Exonic
1149520145 17:57312492-57312514 AGCACCCTGCTGCAGTTTCAAGG + Intronic
1150272324 17:63874351-63874373 GTGTCTCTGCTGCAGGTCCAAGG - Intronic
1150278013 17:63911950-63911972 GTGTCTCTGCTGCAGGTCCAGGG - Intronic
1153518590 18:5929981-5930003 TTCTCTCTGATGTAGGTACAGGG + Intergenic
1153807483 18:8721822-8721844 AGCTCTGTGGGGCAGGGACAGGG + Intronic
1153954168 18:10082064-10082086 AGCTCTCTGCTGCGGACACACGG - Intergenic
1157579257 18:48763974-48763996 AGTTCTCTGCTCCAGAGACAAGG - Intronic
1158351821 18:56572031-56572053 AGCTCTCTTCTCCAGGTATCCGG - Intergenic
1159252985 18:65906156-65906178 ATCTCTCTGCTGCTGCAACATGG + Intergenic
1159941554 18:74412590-74412612 AGCTCCCTGCTGCAGGGGCAGGG - Intergenic
1160272185 18:77397234-77397256 AGCTCTCCACAGCAGGGACATGG - Intergenic
1160483625 18:79266455-79266477 AGATCTTTGCTGCAGAAACAAGG - Intronic
1160687059 19:441980-442002 CTCTCCCTGCTCCAGGTACATGG - Intronic
1161258901 19:3324744-3324766 CTCTCTCTGCTGCAGCCACACGG + Intergenic
1163815954 19:19464682-19464704 ATGTGTGTGCTGCAGGTACAGGG + Intronic
1164477703 19:28588003-28588025 ATCTCTCTGCGGCAGTTTCACGG - Intergenic
1165139447 19:33690033-33690055 AGGTTTCTGCTGCCGGGACACGG + Intronic
1165146790 19:33735987-33736009 TGCTCCCTGCTGCAGGGCCAGGG + Intronic
1166516448 19:43450696-43450718 AGCTCTATGCTGCAGGGAAGCGG - Intergenic
1166992159 19:46699096-46699118 CCCTCCCTGCTGCAGCTACATGG + Intronic
1167467397 19:49657588-49657610 CGCCCTCTGCTGCAGGTGCCCGG - Intronic
1167548781 19:50145191-50145213 TGCTCTCTGCTTCTGGTGCATGG - Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
926107790 2:10163225-10163247 AGCTCTTGGCTGCAGGGAGAGGG + Intronic
926718889 2:15943899-15943921 AGCTCCCTGCTCCAAGGACAAGG - Intronic
928006525 2:27567253-27567275 AGCTCTCTCCTTCAGTTAGAAGG + Intergenic
935470601 2:103455311-103455333 TGCTCTCTGCAGGTGGTACAAGG + Intergenic
935675108 2:105588374-105588396 AATTCTCTGCTGCAGGTGGATGG + Intergenic
938381315 2:130837805-130837827 AGCTGTCAGCTGCAGGTCCAGGG + Intronic
939118661 2:138089963-138089985 ATCTCTCAGCTTCAGGTATAAGG - Intergenic
940990327 2:160089387-160089409 AGCTCTCTCCTGCAGAGAGACGG + Intergenic
943728570 2:191277763-191277785 CCTTCTCAGCTGCAGGTACAGGG - Intronic
946161963 2:217840896-217840918 AGCTCACTTCTGCATGAACATGG - Intronic
948541286 2:238692963-238692985 TGCTGTCTGCAGCAGGTGCATGG + Intergenic
948778410 2:240302021-240302043 AGATCTCTTCTGCAGGTTTAGGG - Intergenic
948830493 2:240596234-240596256 ACCTCCCTGCTGCAAGCACAAGG - Intronic
948951051 2:241252003-241252025 GGCATTCTGCTGCAGGTCCAAGG - Intronic
1169138701 20:3213970-3213992 GTCTTTGTGCTGCAGGTACAGGG + Exonic
1172321287 20:33997093-33997115 AGGTCTCTTCTGCAGATACTGGG - Intronic
1173137107 20:40448050-40448072 ACCTTTCTGCTGCAGATATAGGG - Intergenic
1174485661 20:50859630-50859652 ACCGCTCTGCTGCATGTAGAGGG + Intronic
1175178787 20:57130336-57130358 AGGTCTCTGCTTCAGGCTCAGGG - Intergenic
1176869830 21:14075678-14075700 TGCTCCCTGCTGCGGGCACACGG - Intergenic
1177604469 21:23360113-23360135 AGAGATTTGCTGCAGGTACAGGG - Intergenic
1177614414 21:23499058-23499080 AGATTTTTGCTGCAGGGACAGGG - Intergenic
1179375950 21:40849790-40849812 AGATCTCTAATGCAGGTAGAAGG + Intergenic
1179478013 21:41660153-41660175 AGAACACTGCTCCAGGTACAGGG + Intergenic
1179642753 21:42758033-42758055 AGCTGCCTGCTGCCTGTACAGGG - Intronic
1179887884 21:44322207-44322229 AGCTGCCTGCTGCGGGTACCTGG + Intronic
1180200377 21:46220556-46220578 TGCTCTCTGCTGCATGCGCAGGG - Intronic
1182567552 22:31211612-31211634 AGCACTCCCCTGCAGGAACATGG - Intergenic
1183709364 22:39493414-39493436 AGGTACCTGCTGCAGGTACTTGG + Intergenic
1184048981 22:41990378-41990400 AGCCCTGTGCTGGATGTACAGGG + Intronic
1184245201 22:43232211-43232233 TCCTCTCTTCTGCAGGTTCAGGG + Intronic
949163407 3:909299-909321 AGCTCTCCTCAGCAGGTATATGG + Intergenic
950046610 3:9952050-9952072 ATCTCTCTGCCGCAGGGACTGGG + Intronic
951550234 3:23870008-23870030 AGCTTTCTAATGCAGTTACAGGG + Intronic
951749472 3:26017959-26017981 AGCCATCTGGTTCAGGTACAGGG - Intergenic
952968549 3:38636548-38636570 AGCTCTCTGCTGCAGCAGCCGGG + Intronic
953832980 3:46317872-46317894 AGCTCTAGGCTGTAGGAACACGG - Intergenic
954323188 3:49845876-49845898 ACCTCACTGCTTCAGGAACATGG - Intronic
954360935 3:50122516-50122538 GGGTCTCACCTGCAGGTACAAGG + Intergenic
956706313 3:72002117-72002139 AGCTCTCTCCTGCAGAGAGAGGG - Intergenic
957837730 3:85619570-85619592 AGCTCTCTGATGGAAATACATGG + Intronic
959399852 3:105886642-105886664 TGCTCTCTGCTCCAGCAACATGG + Intergenic
964323188 3:155519205-155519227 TGGTCCCTGCTGCAGGTGCATGG - Intronic
964475515 3:157094649-157094671 AGCTCTATGCTGCGGGTATAAGG + Intergenic
965617770 3:170612479-170612501 AGGTCTGTGCTGCAAGGACAGGG - Intronic
966568348 3:181409051-181409073 ATCTATCTGCTGCAGAAACAGGG - Intergenic
970260370 4:14217974-14217996 AGCTCTCTTCTGCTGGCAGATGG - Intergenic
972313540 4:37903472-37903494 AGCTGTCTGCCACATGTACAGGG + Intronic
975515984 4:75248862-75248884 TTCTCACTGCTGCAAGTACAGGG + Intergenic
975545698 4:75558051-75558073 TGCTCTCTGCTGCAGATCCCTGG + Intronic
976193069 4:82507547-82507569 TGCTCGCTGCTCCAGGTACTGGG + Intronic
981722593 4:147816352-147816374 AGCTCTGTGCTCCAGGTTTATGG + Intronic
982033432 4:151323879-151323901 AGCTTTCTGCTGAAGGTAACAGG + Intronic
982374674 4:154676952-154676974 ATCTCTCTGCTGCAGCTGAAGGG - Intronic
984884181 4:184435525-184435547 AGCTCTCTGATGCATTTAAATGG - Intronic
986082742 5:4411005-4411027 AGTTCTCTCCTGGAGGCACATGG - Intergenic
986105501 5:4655863-4655885 AGATGTTTGCTGCAGGGACAGGG - Intergenic
986222878 5:5786057-5786079 AGCTGTCTCCTGGAGATACAAGG + Intergenic
986713340 5:10503537-10503559 AGCTCACAGCTGCAGGTGCCAGG + Intergenic
992189577 5:74277938-74277960 AACTCTCTGCTCTGGGTACATGG - Intergenic
992675643 5:79103197-79103219 CTCACTCTGCTCCAGGTACATGG - Intronic
992871407 5:81009068-81009090 TGCTCTCAGCTGCAGGCCCAGGG - Intronic
993007944 5:82448331-82448353 AGCTCTATTTTGCAGGTAAAAGG + Intergenic
995423540 5:111993324-111993346 AGCTGTGTGCTGCAAGTACAAGG + Intronic
995881678 5:116850770-116850792 AGCTCTCTGCTGCAGAGAGAGGG + Intergenic
996568395 5:124906354-124906376 AGTTCTCTTATGCAGGAACAAGG + Intergenic
997103507 5:130994066-130994088 TGCTCCCTGCTGTAGGGACAGGG - Intergenic
997905442 5:137811879-137811901 AGATCTCTTCTGCATGTTCAGGG - Intergenic
1002635526 5:180606130-180606152 TGCCCTCTGCTGCCGATACAGGG + Intronic
1004900421 6:20188545-20188567 AGCTCTCTGCCGCAGAGAGAGGG + Intronic
1012771300 6:103437971-103437993 AACTGTATCCTGCAGGTACAAGG + Intergenic
1017033013 6:150240861-150240883 TGCTCTCTGCTCCAGGTCCTTGG + Intronic
1018440594 6:163808778-163808800 TGCTCTCTGCTGAAGCTTCAAGG - Intergenic
1019551333 7:1604055-1604077 AGCTCCAGGCTGCAGGGACAGGG + Intergenic
1023278825 7:38548646-38548668 AGCTCTCTGCTGCAGAGAGAGGG + Intronic
1024134978 7:46397415-46397437 AGCTCTCTTTTGCATGTAGATGG - Intergenic
1024888280 7:54169724-54169746 AGCTCTCTGCTGCAGAAAGGGGG - Intergenic
1024943797 7:54788734-54788756 CGCTCTCTTCTGCAAGTCCAGGG - Intergenic
1025798750 7:64764072-64764094 GGCTCCCTTCAGCAGGTACATGG + Intergenic
1026556315 7:71411688-71411710 AGCTGTCTCCTGCAGGGGCAGGG - Intronic
1026899694 7:74029910-74029932 AGCTCTCTGCCCCAGGTCAAGGG + Intronic
1029443499 7:100600832-100600854 AGCCCTCTGCAGCATGTCCAGGG - Exonic
1032069074 7:128792549-128792571 AGCTCTGAGCTGCAGGAAGAGGG - Intronic
1034965150 7:155386228-155386250 TGCTGGCTGCTGCAGGGACACGG - Intronic
1035365116 7:158344270-158344292 AGCTGTCTTCAGCAGGAACAAGG + Intronic
1035897998 8:3425636-3425658 GGCTCCCTGCTGCTGGGACAGGG - Intronic
1036097598 8:5741286-5741308 ACCTGTCTGCTGCAGGGGCAGGG - Intergenic
1036427701 8:8661387-8661409 AGCTCTCTCCTGCAGAGATAGGG - Intergenic
1039052620 8:33508671-33508693 GGCTCTCCCCTACAGGTACATGG + Intronic
1040575934 8:48651556-48651578 AGCTCACAGGTGCAGGTGCATGG - Intergenic
1042444534 8:68868674-68868696 AGCTCTCTCCTGCAGAGAGAGGG - Intergenic
1045357142 8:101399352-101399374 AGATCCCTGCTGCAGGACCAAGG + Intergenic
1045573419 8:103393382-103393404 AGGGCACTGCTACAGGTACAAGG - Intergenic
1047446441 8:124924406-124924428 AGCTCATTGCAGCATGTACAAGG - Intergenic
1048013332 8:130476235-130476257 ACATCTCTGCTACAGGTTCATGG + Intergenic
1048046618 8:130778907-130778929 AGCGCTATGTTGGAGGTACAAGG - Intergenic
1049559887 8:143304691-143304713 GGCTCACAGCTGCAGGGACACGG + Intronic
1053590993 9:39514564-39514586 GGCTCTCACCTGCAGGTTCAGGG - Intergenic
1053848841 9:42269936-42269958 GGCTCTCACCTGCAGGTTCAGGG - Intergenic
1054575313 9:66850726-66850748 GGCTCTCACCTGCAGGTTCAGGG + Intergenic
1056761352 9:89417721-89417743 AGCTTTCTGGTGCAGGCACCAGG + Intronic
1057203507 9:93156613-93156635 TTCTCCCTGCTGCAGGTACGGGG + Intergenic
1059390191 9:113994381-113994403 AGCTCTTTGCTGCAGCCACTCGG + Intronic
1061402792 9:130377661-130377683 AGCTCGCGGCTGCAGGTCCTGGG + Intronic
1061746079 9:132741154-132741176 AGCTCTCAGGTGCAGGTATGGGG + Intronic
1062190001 9:135243062-135243084 AGCTCAGTGCTGCAGGGTCATGG - Intergenic
1186812242 X:13201811-13201833 AGCTCTCTCCTGCAGAGAAAGGG + Intergenic
1187851804 X:23598452-23598474 AGCTCTCTTCTGGAGGTAAATGG + Intergenic
1192356024 X:70404891-70404913 TACTCTCTGCTGCAAGTACAAGG - Intronic
1193981354 X:88185570-88185592 AGAGGTCTGCTGCAGGAACAGGG + Intergenic
1194543563 X:95204731-95204753 AGTTATCTGCAGCAGGAACATGG - Intergenic
1196196877 X:112846150-112846172 AGCTGGCTTCTGCATGTACAGGG - Intergenic
1196401597 X:115322791-115322813 AGCTCTCTGCTGCAGAGAGGGGG - Intergenic
1196960533 X:120995272-120995294 AGGTCTCTTCTGCAAGTAGAAGG - Intergenic
1197721842 X:129750628-129750650 AGCTCTGTGCTGCAGGGCCCGGG - Intronic
1199056802 X:143306201-143306223 AGCTCTCTGTAGCAGATACTGGG + Intergenic
1199425122 X:147692540-147692562 AGCAGTCTTCTGCAGGTGCAGGG - Intergenic
1200456792 Y:3404031-3404053 AGCTGTTTGCTGTAGTTACAGGG + Intergenic
1201701471 Y:16887047-16887069 AGCTCTCTGCTGCAGAGAGGAGG + Intergenic
1201973246 Y:19818406-19818428 AGCTCTCTGCTGCACAGAGAGGG + Intergenic