ID: 1077909859

View in Genome Browser
Species Human (GRCh38)
Location 11:6564280-6564302
Sequence TAGGCCAGTGAGGAGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 332}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077909859_1077909868 17 Left 1077909859 11:6564280-6564302 CCTGCACCCTCCTCACTGGCCTA 0: 1
1: 0
2: 1
3: 24
4: 332
Right 1077909868 11:6564320-6564342 CCTTCCACTCCAGAAGCTGAAGG 0: 1
1: 0
2: 3
3: 43
4: 341
1077909859_1077909869 18 Left 1077909859 11:6564280-6564302 CCTGCACCCTCCTCACTGGCCTA 0: 1
1: 0
2: 1
3: 24
4: 332
Right 1077909869 11:6564321-6564343 CTTCCACTCCAGAAGCTGAAGGG 0: 1
1: 0
2: 1
3: 52
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077909859 Original CRISPR TAGGCCAGTGAGGAGGGTGC AGG (reversed) Intronic
900742198 1:4337441-4337463 GAGGCCAGTGAGGTGGAGGCTGG - Intergenic
900936244 1:5768035-5768057 CAGCCCAGGGATGAGGGTGCTGG - Intergenic
901652971 1:10753595-10753617 CAGGCCAGGGAGGCGGGTGGGGG + Intronic
901712444 1:11126309-11126331 GAGGCCAGGGAGGAGGCAGCTGG - Intronic
901814750 1:11787773-11787795 GAGTACAGTGAGGAGGGTGGAGG - Exonic
902082325 1:13829441-13829463 TAGGCTGGTGGGGAGGGGGCAGG + Intergenic
902098310 1:13964836-13964858 TACCACAGTGAGAAGGGTGCAGG + Intergenic
903328679 1:22585990-22586012 CAGGCCAGGGATGGGGGTGCTGG - Intronic
904592108 1:31620764-31620786 TAGGTGAGTGAGGAGGCTGACGG - Intronic
905174201 1:36125815-36125837 CAGGCCACCGAGGAGGCTGCGGG + Intergenic
905657080 1:39691983-39692005 TGGGGCAGAGAGGAGGGTGCTGG + Intergenic
907106974 1:51892154-51892176 TAGGCCAGTGAGAACTGTGTCGG - Intergenic
907246115 1:53110141-53110163 TGAGCCAGTGAGGAGGCTGCAGG - Intronic
907247301 1:53116338-53116360 CAGTCCAGTGAGGTGGGGGCAGG - Intronic
907252048 1:53146101-53146123 TAAGCCAGGGAAGGGGGTGCTGG + Intergenic
907311400 1:53541033-53541055 CAGGCCAGTGAAGAGTGTGGGGG + Intronic
907412832 1:54294609-54294631 CAGCCCAGTGAGCTGGGTGCAGG + Intronic
909077839 1:71074208-71074230 TAGGCCACTGTGCAAGGTGCTGG - Intronic
909259054 1:73463780-73463802 CAAGCCAGGGAAGAGGGTGCAGG + Intergenic
912430067 1:109624255-109624277 TAAGCCAGGGTGGAGGGTGCTGG + Intronic
913141193 1:115942933-115942955 CAGCCAAGGGAGGAGGGTGCTGG - Intergenic
915590651 1:156868402-156868424 CAGGTCATTGAGGAGGGTGGGGG + Intronic
915732865 1:158066631-158066653 TAGGTCAGGGAGGCAGGTGCAGG + Intronic
920378708 1:205523368-205523390 AAGGCCAGTGGGGAGGGGGTGGG - Intronic
921262327 1:213395139-213395161 TAGTCCAGGGAGGATGGTGGAGG + Intergenic
922161997 1:223084893-223084915 AAGGGCAGTGGGGAGAGTGCTGG + Intergenic
922613045 1:226944107-226944129 GAGGCCAGAGAGGAGGGAGGAGG + Intronic
923044218 1:230343605-230343627 TCGTGCAGTGAGGAGGATGCTGG - Intronic
923374237 1:233344070-233344092 AGGGCCAGGTAGGAGGGTGCAGG + Intronic
1063229084 10:4046169-4046191 TATGACAGAGAGGAGGGAGCAGG + Intergenic
1063425457 10:5946950-5946972 TTGGCCTGTGAGGAGGCCGCAGG + Intronic
1066303510 10:34117432-34117454 GAGGGCAGTGGGGAGGGGGCAGG + Intronic
1067165708 10:43864861-43864883 CAGGGAAGTGAGGAGGGTGGGGG + Intergenic
1070289785 10:75106621-75106643 TGGGCCAGTGTGGAGGGCTCTGG - Intronic
1070335359 10:75450184-75450206 TAGGACAGTGATGGGGGTGGGGG - Intronic
1070354739 10:75628918-75628940 TTGGGCAATGAGGAGGCTGCTGG - Intronic
1070692435 10:78537081-78537103 TAGGACCGTGAGCAGGGTGCTGG - Intergenic
1072197962 10:93132835-93132857 TTGGGTAGGGAGGAGGGTGCAGG + Intergenic
1072875660 10:99170358-99170380 CAGGCCAGAGAGGAGGGAGCTGG - Intronic
1074828520 10:117231997-117232019 TGGGGCAGAGAGGAGGCTGCTGG + Intergenic
1076254716 10:129012818-129012840 GACCCCAGTGAAGAGGGTGCAGG + Intergenic
1076554720 10:131313656-131313678 TAGGACAGTGGGGATGGGGCTGG - Intergenic
1076684930 10:132194288-132194310 GAGGCCAGTGAGCAGTGTTCGGG + Intronic
1076834051 10:133012122-133012144 GAGGGCAGTGAGGAGGGATCTGG + Intergenic
1077218253 11:1404096-1404118 TGGGACAGTGGAGAGGGTGCTGG - Intronic
1077299376 11:1840112-1840134 TCGGCCGGTGAGGTGGGGGCGGG - Intronic
1077909859 11:6564280-6564302 TAGGCCAGTGAGGAGGGTGCAGG - Intronic
1079019624 11:16898763-16898785 GAGGCCAGTTAGGAGGGTGTTGG - Intronic
1079907664 11:26269171-26269193 TTGGCCAGTATGGAGGGTGGAGG - Intergenic
1081775718 11:45674809-45674831 CAGGCCAGTGAGGTGGGGGTGGG + Intergenic
1082896301 11:58193785-58193807 TAGGCCAATGAGGAGAGTCTGGG + Intergenic
1083628614 11:64084675-64084697 AGGGCCAGTCAGGAGGGAGCAGG + Intronic
1083904278 11:65660042-65660064 TTGGCCAGTGAGGGAGATGCAGG + Intronic
1084429681 11:69104257-69104279 AAGGCCAGAGAGTGGGGTGCAGG + Intergenic
1084539453 11:69776789-69776811 TTGGCCAGGGTGCAGGGTGCAGG + Intergenic
1085039138 11:73316872-73316894 GAGGCCAGTCAGAAGGCTGCTGG + Intronic
1085465413 11:76719990-76720012 TAGGCCAGTGGGGATGGGGGTGG - Intergenic
1086437063 11:86792010-86792032 CAGCCCTGTGAGGAGGGTACTGG + Intronic
1086959684 11:92969589-92969611 GAGGCCAGTGGGGAGGGGTCTGG - Intergenic
1089009824 11:115123242-115123264 TGGGGCAGGGAGGAGGGTGGAGG - Intergenic
1089124142 11:116164492-116164514 TAGGACAGTCAGGTGGGGGCAGG + Intergenic
1089308032 11:117538911-117538933 GTGGCCAGTCAGGAGGCTGCTGG - Intronic
1089435840 11:118465648-118465670 GATGCCAGTGAGGAGAGTGCTGG - Intronic
1089683422 11:120132229-120132251 GAGGACAATGGGGAGGGTGCTGG - Intronic
1091058221 11:132438687-132438709 TGGGCCAGTGTGCAGGGTGTAGG + Intronic
1091655221 12:2341157-2341179 TGGGGCAGTGAGGGGAGTGCTGG + Intronic
1094525754 12:31229584-31229606 AGAGACAGTGAGGAGGGTGCAGG + Intergenic
1096030855 12:48413450-48413472 GAGGCCACTGAGGAGGTTGGAGG + Intergenic
1096070623 12:48773714-48773736 TAGGTCAGGCAGGAGAGTGCAGG - Intronic
1096707277 12:53430154-53430176 TAGGCCAGTTGGAAGGGTGGTGG - Exonic
1096754991 12:53792026-53792048 TAGGCTAGAGAAGAGGGGGCAGG - Intergenic
1098386275 12:69922115-69922137 CCTGCCAGTGAGCAGGGTGCAGG + Intronic
1101504037 12:105330607-105330629 TTGGCCAGTGCCGAGGTTGCTGG + Intronic
1101843307 12:108342686-108342708 TGGGCCAGTGAGGAAGGCGTGGG + Intergenic
1102112595 12:110376019-110376041 AAGGCCACTGAGGAGGGTAGAGG - Intronic
1102254537 12:111407826-111407848 GAGGATAGTGAGGAGGGTCCTGG + Intronic
1102789112 12:115629480-115629502 AAGGCTAGTTAGGAGGCTGCCGG + Intergenic
1104055695 12:125228342-125228364 TAGGCGAGTGAGGAGGGATTTGG + Intronic
1104182894 12:126399483-126399505 AAGGCCAGTGTGGTGGGTGAGGG - Intergenic
1105607633 13:21939980-21940002 TGGCCCAGTGGGGAGGGTGGTGG - Intergenic
1106571333 13:30930727-30930749 CAGCACAGTGAGGTGGGTGCTGG + Intergenic
1107012031 13:35679015-35679037 CAGGCCCGTGAGGGGGGTGGTGG + Intergenic
1107629018 13:42324230-42324252 TAGGACAGAGAGGAAGGTGAGGG + Intergenic
1109437947 13:62331076-62331098 CAGGCCAGGGAGGTGGGTGGGGG - Intergenic
1109914940 13:68970967-68970989 TAGGCCAGTGATGTGGAGGCTGG - Intergenic
1113462238 13:110490454-110490476 TTGGCCAGTGGGGAGACTGCTGG + Intronic
1113499130 13:110759555-110759577 TAGGACACTGAGGATGGTACAGG + Intergenic
1113736101 13:112680020-112680042 GAAGGCAGTGAGGTGGGTGCCGG + Intronic
1114199936 14:20510631-20510653 GAGGCCACTGAGGAGGGAGACGG + Exonic
1114211887 14:20622913-20622935 GAGGTTGGTGAGGAGGGTGCTGG + Intergenic
1114595219 14:23906284-23906306 TAGACCAGTGAGGAGCTTCCTGG - Intergenic
1115766536 14:36628785-36628807 CAGGCCATTGAGGATGGAGCTGG - Intergenic
1117991593 14:61439284-61439306 TAGGCAAGTGAAGAGCGTGTGGG + Intronic
1118446066 14:65852207-65852229 TCGTCCAGTGAGGAGGCAGCTGG + Intergenic
1118474914 14:66107706-66107728 GAGGCAAATGAGGAGGGAGCAGG + Intergenic
1119058423 14:71448055-71448077 CAGTCCTGTGAGGAGGGTGATGG + Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1121226964 14:92328179-92328201 TAGGCCAGGGAGGAAGATGCTGG - Intronic
1121641286 14:95486294-95486316 TGGGTCACTGAGGAAGGTGCAGG - Intergenic
1122366581 14:101198103-101198125 GAGGCCAGTGAGGAGAGGGCAGG + Intergenic
1122717879 14:103706255-103706277 CAGGCCCGTGAGGAGGTGGCTGG + Intronic
1123108031 14:105852113-105852135 TGGCACAGGGAGGAGGGTGCAGG - Intergenic
1128378262 15:67092630-67092652 CAGGATACTGAGGAGGGTGCTGG + Intronic
1128448174 15:67783227-67783249 CAGTCCAGTGAGGAAGGTGAGGG + Intronic
1128544630 15:68558754-68558776 TAGGCCTTTGTGGAGGCTGCAGG + Intergenic
1128818181 15:70629545-70629567 TAGGGCAGGGAGGAGGGAGAGGG - Intergenic
1129152333 15:73696895-73696917 AGGGCCAGTGAGGGGGGTGATGG + Intronic
1130347659 15:83063704-83063726 TAGGCCAGACAGGATGGTGCAGG - Intronic
1132844586 16:1993937-1993959 TGGGCCAGGAAGCAGGGTGCAGG - Exonic
1133048054 16:3100043-3100065 TGAGCCAGTCAGGAGGGTCCTGG - Intergenic
1133061831 16:3179938-3179960 CAGCCCAGGGAGGTGGGTGCCGG - Intergenic
1133974256 16:10589193-10589215 TTGGCCAGAGAGCAGGGGGCAGG + Intergenic
1135190160 16:20348198-20348220 GAGGCCAGTGGGGAGGAAGCGGG - Intronic
1135871160 16:26151852-26151874 TAGCCAAGTGGGGAGTGTGCAGG + Intergenic
1136469945 16:30473475-30473497 TAGAGCTGGGAGGAGGGTGCTGG + Intronic
1136520591 16:30793398-30793420 CCAGCCAGTGAGGATGGTGCAGG - Intergenic
1136616799 16:31403472-31403494 AAGGCCAGTGGGGAGGGCCCAGG - Intronic
1139476725 16:67206559-67206581 CAGTCCAGTGTGCAGGGTGCGGG - Intergenic
1141093131 16:81144056-81144078 GAGCCCAGTCAGGAGGGTGAGGG - Intergenic
1141245469 16:82302907-82302929 TGAGGCAGGGAGGAGGGTGCGGG - Intergenic
1141662527 16:85449098-85449120 GGGGCCAGTGAGGTGGGAGCAGG + Intergenic
1141804186 16:86331899-86331921 TAGCCCAGTGAGGCCTGTGCTGG - Intergenic
1142009855 16:87708409-87708431 GAGGACAGTGAGGAGGTTGAGGG - Exonic
1142534208 17:602574-602596 TGGGCCAGTGGGAAGGCTGCAGG + Intronic
1142812072 17:2400091-2400113 TGGCCCCGTGGGGAGGGTGCGGG - Intronic
1142902434 17:3020399-3020421 TAGACCAGGGAGGAGGATGAGGG + Intronic
1145275207 17:21425004-21425026 CAGGCCAGGGAGGAGGGCCCTGG + Intergenic
1145313062 17:21710901-21710923 CAGGCCAGGGAGGAGGGCCCTGG + Intergenic
1145711483 17:26982707-26982729 CAGGCCAGGGAGGAGGGCCCTGG + Intergenic
1145781864 17:27568699-27568721 TAATCCTATGAGGAGGGTGCAGG - Intronic
1148019119 17:44541993-44542015 GGGGCCTGTGAGGAGGGAGCCGG - Intergenic
1148218406 17:45846423-45846445 CAGGCTGGTGAGCAGGGTGCTGG - Exonic
1148749499 17:49936395-49936417 GAGGGCAGTGAGGAGGCTGGGGG - Intergenic
1148799527 17:50214573-50214595 AAGGCCAGTGTAAAGGGTGCCGG - Intergenic
1149656173 17:58310648-58310670 TTGGCCAGTGAGGGAGCTGCGGG + Exonic
1151022487 17:70633584-70633606 TAGACAAGTGTGGAGGGTGGTGG - Intergenic
1151080068 17:71319229-71319251 TAGGGCAGTGAGGACTATGCTGG - Intergenic
1151271013 17:72996051-72996073 GAGGGCAGTGTGGAGGGTGCTGG - Intronic
1151411057 17:73930019-73930041 TGGGCCAGTGCAGAGGATGCGGG + Intergenic
1151487523 17:74410589-74410611 TAGGCCTGGGAGAAGGCTGCAGG + Intergenic
1151512765 17:74571281-74571303 TAGCACAGTGAGGAAGGTTCTGG + Intergenic
1151679045 17:75614372-75614394 CAGGCCAGGGAGAGGGGTGCTGG - Intergenic
1151915338 17:77113973-77113995 TAGGCCTGTGAGTAGGGTAGGGG - Intronic
1152244811 17:79179821-79179843 ATGGCCAGTGAGGAGGGTTGGGG - Intronic
1152300520 17:79492876-79492898 AAGGCCCGTGAGGAGGGAGGAGG + Intronic
1152529278 17:80907572-80907594 GAGGCCAGGGAGGAGGCTGATGG - Intronic
1152655598 17:81517897-81517919 TAGCCCTGTGAAGAGGGTGGGGG - Intronic
1157325429 18:46665408-46665430 GAGGCCATTTAGGAGGCTGCTGG - Intergenic
1157533379 18:48441008-48441030 TAGGACAGCGAGGAGGTTGACGG + Intergenic
1160297736 18:77653848-77653870 GGGGCCAGTGAGGTGGGAGCAGG - Intergenic
1161221409 19:3119836-3119858 TAGGGCACAGAGGAGGATGCAGG - Intronic
1161415800 19:4145672-4145694 AAGGCCAAGGAGGAGGGAGCAGG + Intergenic
1161568580 19:5017215-5017237 TAGGACCTTGAGGAGGGTGGTGG + Intronic
1162176938 19:8837637-8837659 GAGGCCAGTGTGAAGGGTGAGGG - Intronic
1163370211 19:16897307-16897329 GAGGTGAGTGCGGAGGGTGCGGG - Intronic
1163687058 19:18717683-18717705 CAGCTCAGAGAGGAGGGTGCAGG + Intronic
1163847309 19:19645101-19645123 CACGCCTGTGGGGAGGGTGCTGG + Intergenic
1164686164 19:30168195-30168217 GGGTCCAGGGAGGAGGGTGCAGG - Intergenic
1165306447 19:35005574-35005596 GAGACCAGGGAGGAGGCTGCTGG + Intronic
1165309271 19:35020852-35020874 GAGGCCAGGGAGGAGGCTGCTGG + Intronic
1165319278 19:35075724-35075746 CTGGGCAGTGAGGAGGGTCCTGG + Intergenic
1165490288 19:36119469-36119491 GAGGCCAGGGAGGAAGCTGCCGG - Intronic
1165806943 19:38586205-38586227 CTGGCCAGTCAGGAGGGTGGGGG + Intronic
1166066166 19:40360316-40360338 GAGCCCAGGGAGGAGGCTGCTGG - Intronic
1167048807 19:47066854-47066876 TGGGCCAGGGCGGAGGGGGCGGG - Exonic
1167290807 19:48624424-48624446 CCGGCGTGTGAGGAGGGTGCGGG + Intronic
1167413713 19:49359993-49360015 GAAGGCAGTGAGGAGGGTACCGG - Exonic
1167619080 19:50551339-50551361 CAGGCCAGTGGGGGGGGCGCGGG - Intronic
1168102353 19:54148040-54148062 GAGGCCAGAGAGGAGGCTGCTGG + Intronic
1168168508 19:54571591-54571613 AGGGCCAGTGAGGAGGTTGTGGG - Intergenic
1168251937 19:55146604-55146626 TGGGCCCGGGAGGAGGGGGCGGG - Intronic
1168645901 19:58059317-58059339 TAGGCCGGCGAGGAGGGGGAGGG + Intronic
925130091 2:1488519-1488541 CAGGTCAGGGAGGAGGCTGCCGG - Intronic
925737167 2:6973566-6973588 TAGGCCAGTGAGGATGAGGTTGG + Intronic
926055847 2:9773490-9773512 AAGGGCAGTGTGGCGGGTGCAGG - Intergenic
930021061 2:47002570-47002592 TGAGCCAGGGAGGAGGGAGCAGG + Intronic
930864467 2:56108932-56108954 TAGGTCACTGAGGAGGATGTGGG + Intergenic
932419018 2:71590557-71590579 CAGGTCAGGGAGGAGGCTGCAGG - Intronic
933839582 2:86275690-86275712 CAGGCCAGTCAGGAGGCTGACGG - Intronic
934475553 2:94591204-94591226 ATGGCCAGTGAGGAGGCAGCTGG - Intronic
934609338 2:95722997-95723019 TAGGTTAGTGAGGATGGTGGAGG + Intergenic
935777297 2:106484950-106484972 CAGGGCAGTGTAGAGGGTGCTGG - Intergenic
937230428 2:120395333-120395355 GAGGCCAGGGAGTAGGGTGTGGG + Intergenic
937863859 2:126733318-126733340 GAGGGCAGGGAGGAGGGGGCAGG + Intergenic
938081826 2:128374262-128374284 AAGGGCAGTGAGGGAGGTGCAGG + Intergenic
938307392 2:130265115-130265137 CAGGTCAGTGAGGACAGTGCAGG + Intergenic
938414630 2:131093809-131093831 TTTGCCAGTGCGGAGGCTGCGGG + Intergenic
938447942 2:131391727-131391749 CAGGTCAGTGAGGACAGTGCAGG - Intergenic
941159093 2:162015614-162015636 TAGGTCAGGGAGGAGGGAGCCGG - Intronic
941290418 2:163667272-163667294 TAGGCCAGTTAGGAGAGAACAGG - Intronic
942044544 2:172092290-172092312 AAGACCAGTGAGGAGGGGGCTGG - Intergenic
943676069 2:190717541-190717563 TTGGTGAGTGAGGAGGGAGCAGG - Intergenic
944423102 2:199552152-199552174 GAGGCCACTTGGGAGGGTGCAGG + Intergenic
945050618 2:205820909-205820931 TAGGCCAATGAAGTGGGTGAGGG + Intergenic
945745510 2:213715864-213715886 GATGCAAGTGAGGAGGGTACTGG + Intronic
946249300 2:218403004-218403026 CGGGCCAGTGAGGGGGCTGCGGG - Intronic
946289428 2:218732705-218732727 TAGGGCAGTGGGCAGGATGCGGG + Intronic
946475263 2:220000806-220000828 AAGGCCAGTGAGAAAGATGCGGG + Intergenic
947720112 2:232365113-232365135 AAGGGCAGTGAGTAGGGAGCTGG - Intergenic
947732729 2:232440100-232440122 AAGGGCACTGAGGAGGGAGCTGG - Intergenic
948725879 2:239933629-239933651 TAGCCCTGGGAGGAGGCTGCAGG - Intronic
1169215706 20:3793500-3793522 TGGGCCAGTGAGGGGGGAGGTGG - Intronic
1169285389 20:4303315-4303337 GTGGCCAGAGAGGTGGGTGCTGG + Intergenic
1169317910 20:4608722-4608744 TAGCCTGGTGAGGAGGTTGCAGG + Intergenic
1170573079 20:17643331-17643353 TGGGCGAGTTAGGACGGTGCAGG - Intronic
1172306404 20:33883888-33883910 TAGGCAGGTGAGGACGATGCAGG - Intergenic
1173415023 20:42847444-42847466 CAGGGCAGTGAGCAGGGTGGAGG + Intronic
1174637369 20:52013333-52013355 GAGGCCAGATCGGAGGGTGCAGG + Intergenic
1175759260 20:61550157-61550179 GAGGCCAGTGAGGTTGGGGCAGG - Intronic
1175759302 20:61550291-61550313 GAGGCCAGTGAGGTTGGGGCAGG - Intronic
1175802179 20:61807136-61807158 AAGGCCAGTGGGGCAGGTGCCGG + Intronic
1175867258 20:62185789-62185811 TTGGCCAGTGGGGACTGTGCTGG + Intronic
1176017694 20:62944450-62944472 GAGGCTTGTGAGGAGGGTGCTGG + Intronic
1176038473 20:63051846-63051868 TAAGCCCTTGAGGAAGGTGCAGG + Intergenic
1176370853 21:6060678-6060700 GAAGCCAGGGATGAGGGTGCGGG - Intergenic
1178540466 21:33445217-33445239 TATGCCAGTGTAGAGAGTGCTGG - Intronic
1178961764 21:37072741-37072763 TAGGGCAGGGAGGGGGGTTCTGG + Exonic
1179557386 21:42188521-42188543 TAGCCCAGGGAGAAGGGGGCTGG + Intergenic
1179752666 21:43477863-43477885 GAAGCCAGGGATGAGGGTGCGGG + Intergenic
1179980230 21:44891727-44891749 TCGGCAGGTGAGGTGGGTGCAGG - Intronic
1180119453 21:45737081-45737103 TGGGGCAGTGAGGAGGCTGCGGG + Intronic
1181860461 22:25813883-25813905 TGGGGCAGGGAGGAGGATGCAGG - Intronic
1181992400 22:26847399-26847421 TAGGGAAGTGAGGATGGGGCAGG - Intergenic
1183350275 22:37331038-37331060 CAGGCCAGGGAGGAGGGGGAAGG - Intergenic
1184430391 22:44438790-44438812 GAGGACAGTGAGGTGGGTGACGG - Intergenic
1184793879 22:46719853-46719875 CTGGCCAGTGAGCAGGGGGCTGG + Intronic
1184809964 22:46824652-46824674 AAGACCAGTTAGGAGGGTGGTGG + Intronic
1184961218 22:47930187-47930209 TTGGGCAGTGAGCTGGGTGCAGG - Intergenic
1185398646 22:50604926-50604948 GAGGCCAGCGAGGAGGAGGCGGG + Exonic
952762212 3:36924679-36924701 TAGGGCAACGAGGAGGGGGCTGG - Intronic
953041698 3:39261345-39261367 TGGGCCAGTGAGTACGGTGCAGG + Intergenic
953823561 3:46230807-46230829 AGGGCCAGTGTGGAGGGTGGAGG - Intronic
953903142 3:46854562-46854584 GAGGCCAGTGAGGAGGGTCCAGG - Intergenic
954139474 3:48597402-48597424 TAGTCCAGTGAGGAGTTTGGTGG - Intergenic
954199650 3:49016692-49016714 AAGGCCAGTGGGCAGGGTCCTGG + Intronic
954760613 3:52871020-52871042 TAGGCAAGTGTGAAGGTTGCTGG - Intronic
954917788 3:54163745-54163767 AAGGACAGTGAGGAGGGAGATGG + Intronic
960732379 3:120741583-120741605 AAGGGCAGTGAGGTGGGAGCTGG + Intronic
961228035 3:125271644-125271666 CAGTCCTGTGAGGAGGGTACTGG - Intronic
962207940 3:133450478-133450500 TAGGGCAGAGTGGAGGATGCTGG - Intronic
962659748 3:137589488-137589510 CAGGATACTGAGGAGGGTGCTGG - Intergenic
963808629 3:149752435-149752457 TAGGACAGTGAAGATGCTGCTGG - Exonic
965654073 3:170965211-170965233 TGGGCATGTGTGGAGGGTGCAGG + Intergenic
966947832 3:184789816-184789838 GAGGCCAGTGTGGCGGGAGCAGG + Intergenic
967117607 3:186355714-186355736 TAGGACAGTGATGCTGGTGCTGG - Intronic
967243298 3:187462580-187462602 AAGGCCAGTGGGGTGGGAGCTGG + Intergenic
968533705 4:1111104-1111126 TGGACCAGTGAGGAGGGCACTGG - Intronic
968966551 4:3771801-3771823 TTGCCCTGTGTGGAGGGTGCTGG + Intergenic
969246195 4:5934537-5934559 TGGGGCCGGGAGGAGGGTGCAGG - Intronic
969530814 4:7729267-7729289 TTAGCCAGGGAGGAAGGTGCTGG + Intronic
970070145 4:12148972-12148994 TAGGCAAGTGAGGACCGTGCAGG - Intergenic
972757230 4:42060108-42060130 AAAGCCAATGTGGAGGGTGCAGG - Intronic
973610940 4:52635520-52635542 AAGGCCAGTGAGAAGGGTCAAGG - Intronic
974295550 4:59994432-59994454 TTGAAGAGTGAGGAGGGTGCAGG + Intergenic
982129191 4:152212139-152212161 CATGGCAGTGAGGATGGTGCTGG + Intergenic
982289651 4:153766750-153766772 TAAGCCAGTGAGGGGCGTGGGGG - Intergenic
982710691 4:158755956-158755978 CAGGCCAGAGAGGAGGGGGAGGG - Intergenic
984937193 4:184899619-184899641 GAGGCCAGAGAGGAGTGGGCAGG - Intergenic
985155454 4:186982996-186983018 TAGGGTGGGGAGGAGGGTGCAGG + Intergenic
986168831 5:5299029-5299051 TAGTCCAGAGTGGCGGGTGCTGG - Intronic
986233465 5:5886691-5886713 TACGGCAGAGAGGAGGGTGGGGG + Intergenic
986754615 5:10823969-10823991 TGGGCCTGGGAGGAGGCTGCAGG + Intergenic
987487415 5:18539979-18540001 TAGGCTAGTGAGGAGGGGAGAGG - Intergenic
987964647 5:24855748-24855770 TAGGCCAGTGAGTGGGTGGCGGG - Intergenic
988713830 5:33804722-33804744 TAAGGCAGTGAGGTGGGTGAAGG + Intronic
994145848 5:96393880-96393902 TAGGCTGGGGAGGAGGGAGCTGG + Intronic
998421144 5:141987493-141987515 TAGGCCAGTGGGAATGGAGCTGG + Intronic
998511197 5:142715501-142715523 TAGGCCTATGAGGTAGGTGCTGG - Intergenic
999300593 5:150487779-150487801 TATGGCAGTGCGGATGGTGCAGG + Intronic
1000348288 5:160332569-160332591 GAGGCCAGTGTGGTGGGAGCAGG - Intronic
1000918141 5:167106765-167106787 GAGGGCAGTGAAGAGGGTGGGGG + Intergenic
1001803041 5:174559950-174559972 AAGGCCAGTGGGGTGGGTGGTGG - Intergenic
1001955561 5:175846130-175846152 TTGGCCAGGCAGGGGGGTGCGGG - Intronic
1002838442 6:885206-885228 GAGCTCAGTGAGAAGGGTGCTGG - Intergenic
1003084279 6:3049068-3049090 GAGGCCAGGGAGGAAGGCGCAGG + Intergenic
1003092643 6:3117181-3117203 TGGGCCAGTGAGGACACTGCAGG + Intergenic
1003203644 6:3987476-3987498 TATGGCAGTGAGGAGTGTGGTGG - Intergenic
1004578462 6:16923354-16923376 GATGCCAGTTAGGAGGGTACAGG + Intergenic
1004900830 6:20192419-20192441 CTGGGCAGTGAGGAGGGTGTGGG - Intronic
1006423734 6:33951054-33951076 GATGCCAGGGAGGAGAGTGCTGG + Intergenic
1006734184 6:36260829-36260851 TGGGGCAGGGAGGAGGGTGCGGG + Intronic
1007228337 6:40330269-40330291 GAGGACAGTGAGAAGGCTGCTGG - Intergenic
1008555969 6:52673106-52673128 AAGTCAAGTGAAGAGGGTGCAGG - Intronic
1012818848 6:104059336-104059358 AAGGCAAATGAGGTGGGTGCTGG + Intergenic
1013053491 6:106560254-106560276 TATGCAAGAGAGGAGGGCGCTGG + Intronic
1017859138 6:158379052-158379074 GAGACCAGTTAGGAGGCTGCTGG + Intronic
1018936666 6:168278289-168278311 TAGGCCAGAGGGGAAGGAGCAGG - Intergenic
1019438300 7:1032902-1032924 CAGGGTAGTGAGGAGCGTGCAGG - Intronic
1019489842 7:1307187-1307209 GAGACCAGTGAGGAGGGTGTGGG + Intergenic
1019490488 7:1311051-1311073 TGGGTCACTGTGGAGGGTGCTGG - Intergenic
1019514406 7:1433408-1433430 TCGGGCAGTGATGAGGGTGGAGG - Intronic
1022294209 7:29034570-29034592 GGGGCCTGTCAGGAGGGTGCAGG - Intronic
1023744007 7:43304992-43305014 GAGGCCAGAGAGGAAGCTGCGGG + Intronic
1023821471 7:43983016-43983038 GAGGTCAGGGAGGAGGGCGCTGG - Intergenic
1023998642 7:45177150-45177172 TAGGTCAGGGTGGAGGGTGAAGG + Intronic
1025196820 7:56940481-56940503 GAGGCCAGTGAGGGGAGTGGTGG + Intergenic
1025675128 7:63636456-63636478 GAGGCCAGTGAGGGGAGTGGTGG - Intergenic
1029202204 7:98846710-98846732 TGGGCCAGAAGGGAGGGTGCAGG + Exonic
1029749734 7:102536437-102536459 GAGGTCAGGGAGGAGGGCGCTGG - Intergenic
1029767684 7:102635542-102635564 GAGGTCAGGGAGGAGGGCGCTGG - Intronic
1030420358 7:109300757-109300779 TATTCCAATCAGGAGGGTGCAGG + Intergenic
1030730817 7:112986330-112986352 TGGGGCAGTGAGGAGAGGGCCGG + Intergenic
1031976970 7:128100346-128100368 TCACCCAGGGAGGAGGGTGCAGG + Intergenic
1032094044 7:128928859-128928881 TAGACCAGAGACCAGGGTGCAGG + Intergenic
1032202202 7:129829926-129829948 CCTGCCAGTGAGGAGGGAGCAGG + Intergenic
1033422594 7:141216965-141216987 CTGGCCAGTGAGGAGGGGACAGG + Intronic
1033580092 7:142725197-142725219 TAGGTCAGTTAGGAGGATACTGG - Intergenic
1035062879 7:156082199-156082221 TAGCCCAGTGGGGTGGGAGCTGG - Intergenic
1035092477 7:156325870-156325892 TGGGGCAGTGGTGAGGGTGCTGG - Intergenic
1035243038 7:157544534-157544556 CCGTCCAGTGAGGAGGGGGCGGG + Intronic
1035395593 7:158532912-158532934 GAGGCCAGTCAGGAGGGAGCAGG - Intronic
1036226235 8:6960132-6960154 AATGGCAGTGAGGAGGGTGAGGG + Intergenic
1041289421 8:56294625-56294647 CAGGGCAGTGAGAAGGGAGCAGG + Intergenic
1043196393 8:77297893-77297915 TAGGAAAGTGAGGTGGGTGAGGG - Intergenic
1044582713 8:93838048-93838070 TAGGGAAGTGAGGAGGCTGTGGG - Intergenic
1046665711 8:117000222-117000244 GGGGCCAGTGAGGTGGGTGTGGG + Intronic
1047303784 8:123637064-123637086 GAAGCCAATGTGGAGGGTGCTGG - Intergenic
1047448074 8:124937658-124937680 TTGGCCAGTGAGGCTGGTGTAGG + Intergenic
1048335699 8:133500533-133500555 GAGGGCAGTGATGAGGGTGGGGG + Intronic
1048871652 8:138804091-138804113 TAGGCCAGGGGGAAGGGAGCAGG - Intronic
1049519184 8:143079609-143079631 GAGTCTAGTGAGGAGGGCGCAGG + Intergenic
1049826188 8:144670356-144670378 TGGCCCGGTGAGGAGGGTGATGG - Intergenic
1049944881 9:584683-584705 CAGGCATGTGAGGATGGTGCTGG + Intronic
1050642768 9:7685921-7685943 CAGTCCAGAGAGCAGGGTGCTGG + Intergenic
1052854510 9:33398712-33398734 ATGGCCAGTGAGGAGGCAGCTGG + Intronic
1053272759 9:36761559-36761581 GAGGCCAGGGAGGAGAGGGCGGG + Intergenic
1053549556 9:39061885-39061907 TACGCCAGTGTGGAGGCAGCTGG + Intergenic
1053682513 9:40494874-40494896 ATGGCCAGTGAGGAGGCAGCTGG + Intergenic
1053813669 9:41881960-41881982 TACGCCAGTGTGGAGGCAGCTGG + Intergenic
1053932496 9:43123200-43123222 ATGGCCAGTGAGGAGGCAGCTGG + Intergenic
1054281201 9:63130055-63130077 ATGGCCAGTGAGGAGGCAGCTGG - Intergenic
1054295612 9:63330374-63330396 ATGGCCAGTGAGGAGGCAGCTGG + Intergenic
1054393632 9:64634878-64634900 ATGGCCAGTGAGGAGGCAGCTGG + Intergenic
1054428280 9:65140091-65140113 ATGGCCAGTGAGGAGGCAGCTGG + Intergenic
1054502099 9:65881452-65881474 ATGGCCAGTGAGGAGGCAGCTGG - Intronic
1054616927 9:67305479-67305501 TACGCCAGTGTGGAGGCAGCTGG - Intergenic
1056258090 9:84820738-84820760 TCGGCCAGTGAGCTAGGTGCTGG + Intronic
1057082365 9:92182279-92182301 TAGGGCAGAGAGGAAAGTGCTGG - Intergenic
1057217357 9:93236388-93236410 AAGGTCAGGGAGGAGGGTGGGGG - Intronic
1057304455 9:93904207-93904229 GAGGCCAGTGACCAGGGTGCAGG - Intergenic
1057949514 9:99358796-99358818 GGGGACAGTGAGGAGGGAGCAGG + Intergenic
1061093018 9:128437236-128437258 CCGGCCAGGGAGGAGGGTGCTGG - Exonic
1061252459 9:129434525-129434547 AAGGCCAGTGGGAAGGGGGCTGG + Intergenic
1061533663 9:131234177-131234199 TACTCCAGAGAGGAGGGGGCCGG + Exonic
1062283864 9:135764491-135764513 GAGGCCAGTGGGGCCGGTGCTGG + Intronic
1062383684 9:136299734-136299756 CAGGCCCGTGAGGAAGGGGCTGG - Intronic
1062447516 9:136601896-136601918 GAGTCCAGGGAGGGGGGTGCTGG - Intergenic
1062469670 9:136696940-136696962 GAGGCCAGGGAGGAGGGGGAGGG - Intergenic
1062581591 9:137231369-137231391 AAGGCTAGTGCCGAGGGTGCAGG - Intronic
1189148965 X:38685043-38685065 GAGGCCAGACAGGAGGGTGAGGG - Intronic
1189251065 X:39601120-39601142 TTGGGCAGTGAGGAGGGAGGGGG - Intergenic
1190988656 X:55522926-55522948 CAGCCAAGGGAGGAGGGTGCAGG + Intergenic
1197022205 X:121705329-121705351 CAAGCCAGGGAAGAGGGTGCAGG + Intergenic
1197022231 X:121705540-121705562 TACACCAGTGAAGAAGGTGCAGG + Intergenic
1197146692 X:123179834-123179856 TAGTCCAGAGAGGAAGGTGTTGG + Intergenic
1198914319 X:141650841-141650863 TTGGGCAGTGAGGGGGGTGGTGG - Intronic
1199767603 X:150952510-150952532 TTCCACAGTGAGGAGGGTGCTGG - Intergenic
1200110420 X:153738027-153738049 CATGCCAGGGAGGAGGGGGCCGG + Intronic