ID: 1077910220

View in Genome Browser
Species Human (GRCh38)
Location 11:6566588-6566610
Sequence GCTAGGTTGTGAACTGCTAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 112}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077910213_1077910220 18 Left 1077910213 11:6566547-6566569 CCAAGGGGAAGAGGTTAAGCATC 0: 1
1: 0
2: 0
3: 7
4: 149
Right 1077910220 11:6566588-6566610 GCTAGGTTGTGAACTGCTAAAGG 0: 1
1: 0
2: 0
3: 12
4: 112
1077910210_1077910220 29 Left 1077910210 11:6566536-6566558 CCCTGGCTCTGCCAAGGGGAAGA 0: 1
1: 0
2: 2
3: 28
4: 292
Right 1077910220 11:6566588-6566610 GCTAGGTTGTGAACTGCTAAAGG 0: 1
1: 0
2: 0
3: 12
4: 112
1077910214_1077910220 -6 Left 1077910214 11:6566571-6566593 CCCATGTTACCCCAAGTGCTAGG 0: 1
1: 0
2: 0
3: 12
4: 342
Right 1077910220 11:6566588-6566610 GCTAGGTTGTGAACTGCTAAAGG 0: 1
1: 0
2: 0
3: 12
4: 112
1077910216_1077910220 -7 Left 1077910216 11:6566572-6566594 CCATGTTACCCCAAGTGCTAGGT 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1077910220 11:6566588-6566610 GCTAGGTTGTGAACTGCTAAAGG 0: 1
1: 0
2: 0
3: 12
4: 112
1077910209_1077910220 30 Left 1077910209 11:6566535-6566557 CCCCTGGCTCTGCCAAGGGGAAG 0: 1
1: 0
2: 2
3: 21
4: 299
Right 1077910220 11:6566588-6566610 GCTAGGTTGTGAACTGCTAAAGG 0: 1
1: 0
2: 0
3: 12
4: 112
1077910211_1077910220 28 Left 1077910211 11:6566537-6566559 CCTGGCTCTGCCAAGGGGAAGAG 0: 1
1: 0
2: 4
3: 32
4: 284
Right 1077910220 11:6566588-6566610 GCTAGGTTGTGAACTGCTAAAGG 0: 1
1: 0
2: 0
3: 12
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077910220 Original CRISPR GCTAGGTTGTGAACTGCTAA AGG Exonic
906828211 1:49004592-49004614 GCTAGATTGTGAACTAATTATGG - Intronic
906888034 1:49673828-49673850 GCTGAGTTGTGAAATGCTATGGG + Intronic
907850527 1:58250573-58250595 GCTAGGTGGCGAAATGCTGAGGG - Intronic
907983704 1:59509555-59509577 GCTGGGGTGTGAACTGGTAGGGG - Intronic
911273199 1:95828643-95828665 ACTAGGTTGTGAGCTTCTTAAGG + Intergenic
912063977 1:105712413-105712435 GCTAGGTTGTGTGCTACTTATGG + Intergenic
914795869 1:150919884-150919906 ACTAGTTTGTGAACAGCTCAAGG - Intergenic
916244767 1:162676419-162676441 GCTAGGCTGTGAAATCCTGAAGG + Intronic
916309350 1:163377641-163377663 GCTAGATTGTAAACTTCTTATGG + Intergenic
917291136 1:173473561-173473583 ACTAGATTGTGAACTCCTAAAGG - Intergenic
918089093 1:181272450-181272472 GCTTGCTTGTACACTGCTAATGG - Intergenic
918562253 1:185882990-185883012 GCCAGATTGTGAGCTCCTAAGGG + Intronic
921014590 1:211176850-211176872 GTTAGGTTGGGAACTGCTTAGGG + Intergenic
922357749 1:224792592-224792614 GCTGGGTTGGGCACTGCTGAGGG + Intergenic
923358898 1:233188360-233188382 GCCAGGTTATTAACTGCTGATGG - Intronic
1064228551 10:13508793-13508815 GCTAGGCTGTAAACTCCTGAAGG - Intronic
1067894887 10:50168355-50168377 ATTAGGTTGTGAACAGCAAAAGG + Intergenic
1067953947 10:50771907-50771929 ATTAGGTTGTGAACAGCAAAAGG - Intronic
1071540354 10:86477412-86477434 GCTAGGTTGCTAAATGGTAAGGG - Intronic
1077910220 11:6566588-6566610 GCTAGGTTGTGAACTGCTAAAGG + Exonic
1080098996 11:28437760-28437782 GCTAGATTGAAAACTGCTAGAGG + Intergenic
1086216127 11:84383574-84383596 GCCATGTTGTGAACTGCCTATGG + Intronic
1086669891 11:89533374-89533396 ACTAGACTGTGAACTTCTAAAGG - Intergenic
1087769886 11:102196568-102196590 AGTAGGTAGTGAACTGCTAATGG + Intronic
1089624857 11:119744915-119744937 GCTAGGTTGTGCACTGTGCAGGG + Intergenic
1089680607 11:120117022-120117044 CCAAGGTGGTGAACTGATAAGGG + Intronic
1096339514 12:50785807-50785829 GCTATGCTGTGAACTGCATACGG - Intronic
1096487303 12:51992184-51992206 TCTAGGCTGTGAACTCCAAATGG - Intronic
1097993569 12:65862885-65862907 TATAGGTTGTCAACTGCCAACGG + Intronic
1101712299 12:107279575-107279597 GCTATGCTGTGAACTACTAATGG + Intergenic
1102988956 12:117301093-117301115 GCTCGGCTGTGAACTGCTCCAGG + Intronic
1103313801 12:120034812-120034834 GCTGTGTTGTGAACTGCCTATGG - Intronic
1105396549 13:20042109-20042131 GCTAGGTTGGGAAGTTCTCATGG + Intronic
1115979884 14:39038741-39038763 GCTAGGTTGTGAACCACAAAAGG - Intronic
1128126153 15:65194548-65194570 GCTAGGAGGTGGCCTGCTAATGG - Intergenic
1128594136 15:68929342-68929364 GCTAGGTTTTGAGCTGGGAACGG - Intronic
1130646086 15:85728520-85728542 GCTAGGGTGTGAGCTTCTCAAGG - Intronic
1131622903 15:94086221-94086243 TCTAGTTTGTGAACTTCTATTGG + Intergenic
1134374221 16:13655533-13655555 CCTAGGGTGCTAACTGCTAATGG - Intergenic
1138721708 16:59089994-59090016 GTTTGGTTGTGAACTACTAGGGG + Intergenic
1139571691 16:67816813-67816835 GCTAGGTTATTAACAGCTGAGGG - Intronic
1141610510 16:85178563-85178585 GCAAGGGTGAGAACTGCTGACGG + Intronic
1146055740 17:29580131-29580153 GCTAGATTGTGAGCTCCTTAAGG + Intronic
1148722882 17:49767252-49767274 GGGAGGCTGTGCACTGCTAAGGG + Intronic
1153364922 18:4245098-4245120 GCTACGTTGTTAGCTGCTACTGG + Intronic
1156681522 18:39594941-39594963 GCTATGTTATGAACTGCCTATGG + Intergenic
1162376667 19:10309295-10309317 GCCAGGTGGTGAAGTGCTAGCGG + Exonic
925718895 2:6809459-6809481 GCTAGGTTATGACCTCCTGAAGG + Intergenic
926574128 2:14561667-14561689 GTTAGGTTGTCAACTCCTCAGGG - Intergenic
928259811 2:29756365-29756387 GCTAGGTTGTAAACTCAGAAGGG + Intronic
930180991 2:48356838-48356860 ACTTGGTAGAGAACTGCTAAAGG - Intronic
930864287 2:56107631-56107653 GCTATGTTATAAAATGCTAAAGG + Intergenic
935843348 2:107138142-107138164 GCTAGACTGTGAATTTCTAAAGG + Intergenic
937849363 2:126619248-126619270 GCTGGCTTGTGGAGTGCTAATGG - Intergenic
939164792 2:138628860-138628882 GATAGGCTGTGAACTCCTCAAGG + Intergenic
940136179 2:150438088-150438110 GCTATGATTTGAACTGATAAAGG - Intergenic
944901320 2:204219488-204219510 TCTAGGTTGTGCACTCCTTATGG + Intergenic
946436399 2:219658896-219658918 GCAAGGTTGTAAACTGCATATGG + Intergenic
947565066 2:231188584-231188606 GCAAGGTGGTGAGCTGCTCATGG - Intergenic
1171434958 20:25114798-25114820 ATTAGGTTGTCAACTGATAATGG - Intergenic
1176068663 20:63214857-63214879 GCTACGCTGAGAACTGCTGAGGG - Intronic
1178605278 21:34030975-34030997 GCTAGGTTGTGCACTACTGAAGG + Intergenic
1178638674 21:34328183-34328205 CGTAGGCTGTGACCTGCTAAGGG + Intergenic
1182967585 22:34536444-34536466 GCTAGACTGTGAACTGCTCCAGG + Intergenic
1183004306 22:34888265-34888287 GCTAGTCTGTGAGCTTCTAAGGG + Intergenic
1184591568 22:45487290-45487312 CCTAGGTTGTGCACTCCTTATGG - Intergenic
951990199 3:28668147-28668169 GCTATGCTGTGAACTCCTCAGGG + Intergenic
954509294 3:51107777-51107799 GCTAGGTTGGGAAGTTCTCATGG - Intronic
956228097 3:66982416-66982438 GAGAGGTTGTGACCTGCTCAGGG + Intergenic
956338255 3:68189562-68189584 CCCAGGGTGTGAACTTCTAAAGG - Intronic
957598294 3:82297436-82297458 ACTAGGTTGTCAGCTTCTAAAGG - Intergenic
957677584 3:83389993-83390015 GCTGTGCTGTGAACTGCTTATGG + Intergenic
958068202 3:88572786-88572808 GCAAGGTTGTGCTCTGCAAACGG - Intergenic
963052207 3:141151904-141151926 GCTAGATGGTGAACTCCTAGAGG + Intergenic
964405462 3:156343926-156343948 GCCAGGATCTTAACTGCTAAAGG - Intronic
967721252 3:192819003-192819025 GCTAGAATCTGAACTGCCAATGG + Intronic
971743896 4:30553726-30553748 TCTAGGTTGTGCACTCCTTATGG + Intergenic
975318643 4:72983981-72984003 GCTAGGGTGTGAACTGATTTAGG + Intergenic
979411055 4:120380242-120380264 GCCATGTTGTGAACTGCATATGG - Intergenic
980536277 4:134127494-134127516 ACTGGGTTCTGAACTGGTAATGG - Intergenic
982637456 4:157914956-157914978 GCTAGGATGTAAACTGATAAGGG + Intergenic
983455880 4:167963974-167963996 GCCATGTTGTGAACTGCCTATGG - Intergenic
984473635 4:180210181-180210203 TCTAGGCTGTGAACTTCTCAAGG + Intergenic
986234283 5:5893018-5893040 GTTAGGTTTGGAACTGCTATTGG + Intergenic
986289071 5:6384231-6384253 GCCAAGTTGGGAACTGCTTAGGG - Intergenic
990942312 5:61215021-61215043 GCCATGCTGTGAACTGCTGATGG - Intergenic
991232896 5:64357654-64357676 GGTAGGTTGTGTTGTGCTAATGG - Intronic
991252062 5:64574178-64574200 GCTAGATTCTGAACAGATAATGG - Intronic
993158771 5:84261882-84261904 GCTAGGTTTTCAAATGCTAAGGG + Intronic
995600740 5:113792666-113792688 GCTAGATTGTAAACTGCTTGAGG + Intergenic
998046803 5:138993643-138993665 GCCATGTTGTGAGCTGCTTATGG + Intronic
998846145 5:146311788-146311810 GCTGGGTTGTCTACTGCTACTGG + Intronic
1001789615 5:174444736-174444758 GCTAGATTGTGAACTCATAAAGG + Intergenic
1008079858 6:47182445-47182467 GCTAGGCTGTGAAGTGCTCAGGG + Intergenic
1010034855 6:71313167-71313189 GCTTTGCTGTGAACTGCCAAGGG - Intergenic
1011998902 6:93629015-93629037 GCTAAGTTATGGACTGCCAATGG + Intergenic
1012284342 6:97370257-97370279 ATTAGGCTGTGAACTCCTAATGG + Intergenic
1012318871 6:97817060-97817082 CCTAGGTTGTGAGCTTCTAGAGG + Intergenic
1016707994 6:147135845-147135867 GCTAGATTGTGAGCTCCTTAAGG + Intergenic
1017991017 6:159489855-159489877 GCTGGGCTTTGAACTGCTATTGG + Intergenic
1020831474 7:13100979-13101001 GCTAGCTTATTAACTGCTAAGGG - Intergenic
1025721734 7:64022129-64022151 GCCAGGTTGTAAGCTGCTTATGG + Intergenic
1030295780 7:107925395-107925417 TCTAGGTTGTGCACTCCTTATGG + Intronic
1030666277 7:112282160-112282182 GCTAGTCTGTGAACTCCTTAAGG - Intronic
1032780964 7:135164980-135165002 GCAAGCTTGAGAGCTGCTAAAGG + Exonic
1034901343 7:154909790-154909812 GCTGGGGTGTGAACTGGTAGCGG - Intergenic
1035075500 7:156174878-156174900 GGTAGGTAGAGAACTGCTGAGGG - Intergenic
1037623600 8:20588783-20588805 GCTAGGTTGAGAACCACTGATGG + Intergenic
1039604017 8:38866173-38866195 GAAAGGTTGGGGACTGCTAAAGG - Intergenic
1039911786 8:41832356-41832378 GCTGGGCTGTGAGCTGCAAAGGG - Intronic
1042478702 8:69279855-69279877 TCTAGGTTGTGAGCTCCTAGAGG - Intergenic
1050485240 9:6127286-6127308 ATTAGGTTGTAAACTCCTAAAGG + Intergenic
1051152489 9:14098630-14098652 GATAGGTGATGAACTGCTTAAGG - Intronic
1053096894 9:35336397-35336419 GTTAGGTTATGAACTTCTTAAGG + Intronic
1053139303 9:35672727-35672749 ACTAGATTGTGAGCTGCTCAGGG + Intronic
1055803073 9:80061831-80061853 TCTAGCTTCTGATCTGCTAATGG - Intergenic
1186361856 X:8850600-8850622 GCCATGTTGTAAACTGCTTATGG + Intergenic
1187995715 X:24924519-24924541 CCTAGGATGTGAGCTGCTGAGGG - Intronic
1191203942 X:57814958-57814980 GCTAGGTTGTGAAGTTCTCCTGG + Intergenic
1191767974 X:64721628-64721650 GCTAGACTGTGAACTGCTCCAGG + Intergenic
1191959627 X:66686632-66686654 TCTATGCTGTGAACTGCTTAAGG + Intergenic
1192049786 X:67713821-67713843 GCTAGATGGTGAACTGATATTGG - Intronic
1192626124 X:72730536-72730558 GCTATGGTGTGAACTACCAAGGG - Intergenic
1196646192 X:118119562-118119584 ACCATGTTGTCAACTGCTAATGG - Intergenic
1198320908 X:135518315-135518337 GCTATGTTGTGAACAGCCAATGG + Intergenic