ID: 1077910754

View in Genome Browser
Species Human (GRCh38)
Location 11:6569907-6569929
Sequence GAACCCGAAGCTCAGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077910754 Original CRISPR GAACCCGAAGCTCAGGAGAG AGG Intronic
900421158 1:2556497-2556519 GAACCCGAGCAGCAGGAGAGTGG - Exonic
900892066 1:5456685-5456707 GAAACTGAAGCCCAGGAGTGTGG - Intergenic
902706960 1:18212251-18212273 GAAACTGAAGCTCAGAACAGTGG + Intronic
903345100 1:22679511-22679533 GAACCTGAGGCTTGGGAGAGGGG + Intergenic
904074901 1:27832887-27832909 GAAAACAAAGCACAGGAGAGGGG - Intronic
904539410 1:31222693-31222715 CAAACTGAAGCTCAGGAGAGGGG + Intronic
904868775 1:33603233-33603255 GAACAGGAAGATAAGGAGAGAGG - Intronic
905184649 1:36187776-36187798 GATCCCACAGCTCAGGAAAGAGG + Intergenic
906070628 1:43013773-43013795 GAATCTGGAGCTCAGGAGACAGG + Intergenic
906277437 1:44527132-44527154 GGGCATGAAGCTCAGGAGAGAGG - Intronic
907861293 1:58356182-58356204 GAACCCAAAGCTGAGGACAAAGG - Intronic
908327895 1:63041821-63041843 GAACTCGAAGCACATGTGAGAGG - Intergenic
910142991 1:84047018-84047040 GAGTCTGAAGCTCAGGTGAGAGG - Intergenic
910795098 1:91090172-91090194 GAACCCCAAGGTGAGAAGAGTGG - Intergenic
913464305 1:119123915-119123937 GAGACCAAAGCTCAGGAGAGAGG - Intronic
914255814 1:145960789-145960811 GCACCAGAAGCTCAGGAGTCTGG - Exonic
915906823 1:159884757-159884779 GAACCAGGAGCTCAGGAGAAAGG - Intronic
916329727 1:163601142-163601164 GAACCAGAAGCACAGCAGACAGG - Intergenic
917208922 1:172610746-172610768 GTGCCTGAAGCTCAGGAGTGTGG + Exonic
920945128 1:210521826-210521848 GAAACAGAAGTTAAGGAGAGAGG + Intronic
921596259 1:217056567-217056589 GAAACAGCAGCTCAGGAGAAAGG - Intronic
922085439 1:222342364-222342386 GAACACAGAGCTCAGGAGAAGGG + Intergenic
924401842 1:243691780-243691802 TAACCTAATGCTCAGGAGAGAGG + Intronic
924483671 1:244459893-244459915 GAACCCCAAGGTGAGAAGAGTGG - Intronic
1063210160 10:3872958-3872980 GGGCCCGCAGCACAGGAGAGAGG - Intergenic
1065244083 10:23740107-23740129 CAATCTGAAGCTCAGGGGAGAGG + Intronic
1065483142 10:26214190-26214212 CAACCCCAAGCCCCGGAGAGGGG + Intergenic
1067079046 10:43203382-43203404 GACCCGGGAGCTCAGGAGAAAGG + Exonic
1067415286 10:46097727-46097749 GAAGTTGAAGCGCAGGAGAGAGG - Intergenic
1069945145 10:71980593-71980615 GACTCAGAACCTCAGGAGAGGGG - Intronic
1070757978 10:79005334-79005356 GATGCATAAGCTCAGGAGAGCGG + Intergenic
1074273201 10:111975500-111975522 AGACACGAAGCTTAGGAGAGAGG + Intergenic
1074898600 10:117797683-117797705 GGGGCCGAAGCTCCGGAGAGGGG + Intergenic
1075076336 10:119353123-119353145 GAACCCAAATCCCAGCAGAGAGG - Intronic
1076454324 10:130578886-130578908 GAACCCGAGGCTGAGGACAAAGG - Intergenic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1077910754 11:6569907-6569929 GAACCCGAAGCTCAGGAGAGAGG + Intronic
1081674840 11:44962824-44962846 GACCCCGGAGGTCTGGAGAGGGG - Intergenic
1081720847 11:45286922-45286944 GAAGCCGAGGCTCAGAAGAGAGG + Intergenic
1082996668 11:59261014-59261036 GAAACTGAGGCTTAGGAGAGGGG + Intergenic
1083504392 11:63142207-63142229 GAACCCCAAGGTGAGAAGAGTGG - Intronic
1083991161 11:66246526-66246548 GAACCCGCAGTGCAGGAGAGAGG - Intergenic
1085127501 11:74011568-74011590 GCTCCCGAAAGTCAGGAGAGTGG + Intergenic
1085331626 11:75656741-75656763 GAGCTTGAAGCTCAGGAGAAAGG - Intronic
1087181840 11:95149863-95149885 GAGCCCTAAGCTAAGGGGAGGGG + Intergenic
1088350675 11:108884088-108884110 GAACCAGGGGCTCAGGAGAGAGG - Intronic
1088930921 11:114350033-114350055 GAATCAGAAACTCTGGAGAGTGG + Intergenic
1089147720 11:116342279-116342301 GAGTCTGAAGTTCAGGAGAGAGG + Intergenic
1089925115 11:122249013-122249035 GAATCCGGAGCTCAGACGAGAGG + Intergenic
1090619607 11:128549288-128549310 GGAGCCGGAGCCCAGGAGAGGGG - Intronic
1091339516 11:134799390-134799412 GAGCCCGCAGCTCAGAAGATGGG - Intergenic
1093957379 12:25236412-25236434 GAACTGGAAGCTCAGAGGAGGGG - Intronic
1094092426 12:26665425-26665447 TAACCCGTAGTTAAGGAGAGAGG - Intronic
1094243702 12:28261244-28261266 GAACCTGAAACTCAGAAGAAAGG + Intronic
1094431036 12:30369288-30369310 GAACCCCAAGGTGAGAAGAGTGG + Intergenic
1096694732 12:53341247-53341269 GAACCCAAGGCTCAGGGAAGAGG - Intronic
1097270400 12:57770672-57770694 GAACCCAAAAAACAGGAGAGTGG + Intronic
1099321409 12:81154820-81154842 GAGCCTGGAGCTCAAGAGAGAGG - Intronic
1100968300 12:100038292-100038314 GAGTCTGGAGCTCAGGAGAGAGG - Intronic
1101714756 12:107300995-107301017 CAACCCCAAGCTCAGGAGATTGG - Intergenic
1101813199 12:108125517-108125539 GAACACCAAATTCAGGAGAGAGG - Intergenic
1101818037 12:108160916-108160938 GAAACTGAAGCTCAGGAAGGTGG - Intronic
1102099337 12:110266142-110266164 AAACCCCAAGTTCAGGATAGAGG + Intergenic
1102682078 12:114697568-114697590 GAACCCGGAGCTAAGGGGTGTGG - Intergenic
1102873077 12:116428952-116428974 GGACCCCAAGCCCAGGAGAGGGG - Intergenic
1104067572 12:125318209-125318231 GAACCCCAAGTTGAGGAAAGGGG + Intronic
1104915412 12:132261892-132261914 GGACCTGAAGCTGAGGAGGGTGG + Intronic
1105794234 13:23834407-23834429 GAAGGCAAAGCCCAGGAGAGGGG - Intronic
1105954861 13:25271498-25271520 GAAGCTGAAGCTCAGGCAAGTGG - Intronic
1106819764 13:33451637-33451659 GAAGCCGGAGCTCAGGAATGTGG + Intergenic
1107303075 13:38986473-38986495 CATCCCCAAGCTCAGGAAAGGGG - Intronic
1109252613 13:60038077-60038099 AAACCCAAAACTCAGGATAGTGG + Intronic
1116905332 14:50397747-50397769 GAGCCTGGAGCTGAGGAGAGAGG + Intronic
1117021566 14:51576091-51576113 GCACCCGACACCCAGGAGAGTGG + Intronic
1117817950 14:59617854-59617876 GAACCCCAAGGTGAGAAGAGTGG - Intronic
1119184564 14:72630788-72630810 GAACTGGAAGCTCTGGAGAACGG - Intronic
1119744511 14:77034265-77034287 CAACCCGAAACTCAGGAGAGAGG + Intergenic
1121279456 14:92688492-92688514 GAAACTGAGGCTCAGGAGAGAGG + Exonic
1122270289 14:100565945-100565967 GAACCAAAAGCCCAGGGGAGTGG - Intronic
1122744606 14:103890346-103890368 GAACCCGGAGCTCAGGCAGGAGG + Intergenic
1122902519 14:104787696-104787718 GAAACTGAGGCCCAGGAGAGTGG - Intronic
1122969610 14:105147186-105147208 GAAACTGAGGCTCAGAAGAGAGG + Intronic
1125502512 15:40248379-40248401 GAGCCCGAAGCCTGGGAGAGAGG - Intronic
1126012390 15:44315661-44315683 GAACATAAAACTCAGGAGAGAGG + Intronic
1127347924 15:58119569-58119591 GAAACTGAAGCTCAAGAAAGAGG - Intronic
1128641126 15:69338546-69338568 GAACCCCAAGGTGAGAAGAGTGG - Intronic
1129138691 15:73577250-73577272 GAACCCCAAGGTGAGAAGAGTGG - Intronic
1129457113 15:75681983-75682005 GGACCCGAGGGTCTGGAGAGGGG - Intronic
1129658808 15:77541823-77541845 GAACCAGATGCTGAGGAGGGCGG - Intergenic
1130150046 15:81304736-81304758 GAACCTGAGGCTCAGAGGAGAGG + Intronic
1132114544 15:99125912-99125934 GATCCCAGAGCTGAGGAGAGTGG - Intronic
1133103702 16:3493978-3494000 GAACTGGAAGCTGAGGAAAGAGG + Exonic
1133718041 16:8468159-8468181 CAACTGCAAGCTCAGGAGAGAGG - Intergenic
1133760831 16:8797295-8797317 GAAACCGAATCTCAGGGGTGTGG - Intronic
1134217604 16:12328059-12328081 CAACCCGAGGCTCTGGAAAGTGG - Intronic
1134353225 16:13457381-13457403 GAACTGGAAGTTCAAGAGAGGGG - Intergenic
1134410773 16:14001614-14001636 GGACACGAGGCTGAGGAGAGTGG - Intergenic
1135293795 16:21262214-21262236 AAGCCCAAAGCACAGGAGAGAGG + Intronic
1136094556 16:27945714-27945736 GAACTGGAAACTCAGGAGAGAGG - Intronic
1136416515 16:30107513-30107535 GAAGCCAATGCTCAGGGGAGAGG + Intronic
1138026026 16:53523151-53523173 GAGTCAGAAGATCAGGAGAGAGG - Intergenic
1138491875 16:57381845-57381867 GACCTGGATGCTCAGGAGAGCGG + Intronic
1138601528 16:58057819-58057841 GCCCCTGAAGCTGAGGAGAGAGG - Intergenic
1139549160 16:67663929-67663951 GGTCCCGAAGCTAAGGTGAGAGG - Exonic
1140812969 16:78595936-78595958 GAAACCTGAACTCAGGAGAGTGG + Intronic
1142225137 16:88873513-88873535 GAACCCATAGCTCTGGGGAGGGG - Intergenic
1143628117 17:8122400-8122422 GAACCCGAAGCTGGAGAAAGCGG - Exonic
1145242370 17:21247526-21247548 GAAACCGAGGCCCAGGAGGGAGG + Intronic
1146725556 17:35152880-35152902 GCACTCGGAGCTGAGGAGAGAGG - Exonic
1148281814 17:46354170-46354192 GAGCCTGAAGCTCAGGAGAGAGG - Intronic
1148304039 17:46572109-46572131 GAGCCTGAAGCTCAGGAGAGAGG - Intronic
1149725390 17:58888172-58888194 GAACCTGAAGTTCAGAAGAGAGG + Intronic
1151942079 17:77299099-77299121 GAAGCTGAGGCTCAGGAGAAGGG + Intronic
1151983277 17:77526679-77526701 GAACTTGAAGATCAAGAGAGGGG - Intergenic
1154295630 18:13144480-13144502 GAACCCGCAGATCTGGAGAGTGG - Intergenic
1155698020 18:28707187-28707209 AAACACGAAGCTCTGGAGGGAGG - Intergenic
1156806510 18:41189234-41189256 GAGGCTGAAGCTGAGGAGAGAGG - Intergenic
1156946816 18:42843573-42843595 GAATCCGGAGTTCTGGAGAGAGG - Intronic
1158327720 18:56328644-56328666 GAATCGGGAGCTCAGGAGAAGGG - Intergenic
1158679661 18:59555903-59555925 AAACCCACAGCTCAGGAGATTGG + Intronic
1159011579 18:63063313-63063335 GAATCAGAAACTCTGGAGAGGGG + Intergenic
1159493374 18:69167385-69167407 GAACCCCTAACTCAGAAGAGAGG - Intergenic
1161021353 19:2013194-2013216 GCACCCGAAGGTCAGAAGGGAGG + Intronic
1161355456 19:3816906-3816928 GTCCCCGTAGCTCAGGAGGGAGG - Intronic
1162536018 19:11262956-11262978 GAAACTGAAGCTCAGGAGGGAGG + Intergenic
1162847436 19:13404271-13404293 CCACCCGGAGCTCAGGAGCGTGG + Intronic
1163683463 19:18696908-18696930 GAACCAGAATCACAGGGGAGGGG + Intronic
1165406340 19:35633339-35633361 GAAACAGAAAGTCAGGAGAGAGG - Intronic
1166076622 19:40417501-40417523 GGGCCGGGAGCTCAGGAGAGAGG - Intergenic
1166979076 19:46622132-46622154 GAAACTGAAGCTCAGAAGAAAGG + Intronic
926109261 2:10171631-10171653 GACCCAGATGCTCAGGACAGCGG - Intronic
926126941 2:10277757-10277779 GAACCCTAATCTCTGGAGCGAGG + Intergenic
926687349 2:15708521-15708543 GAACCCAAACCCCAGGAGACTGG - Intronic
930304679 2:49663987-49664009 GAACCCCAACCTCACTAGAGAGG - Intergenic
931623125 2:64230915-64230937 GGATCTGAAGCTCAAGAGAGAGG + Intergenic
931731999 2:65161384-65161406 GAATCTGGAGTTCAGGAGAGAGG + Intergenic
934619438 2:95795083-95795105 GAGCCTGGAGCTCAGAAGAGAGG + Intergenic
934641452 2:96029474-96029496 GAGCCTGGAGCTCAGAAGAGAGG - Intronic
934909861 2:98241685-98241707 GAACACAAAGCCCAGGGGAGGGG + Intronic
936240884 2:110787696-110787718 GAACCAGAAGAAGAGGAGAGTGG - Intronic
936376886 2:111948462-111948484 GAGCCTGCAACTCAGGAGAGGGG - Intronic
938164253 2:129012128-129012150 AAGTCTGAAGCTCAGGAGAGAGG + Intergenic
939604848 2:144241204-144241226 GAACCAGAAACTCTGGAGTGGGG + Intronic
941013167 2:160324328-160324350 TAAGCCAAAGCTCTGGAGAGTGG + Intronic
941308784 2:163904365-163904387 GAACCTGCAGATCTGGAGAGAGG + Intergenic
944600367 2:201297233-201297255 AAGCCTGGAGCTCAGGAGAGAGG + Intronic
944826051 2:203484152-203484174 GCACCTGGAGTTCAGGAGAGAGG + Intronic
946595320 2:221299787-221299809 GAGCCCAAAGATCAGGAGAGAGG + Intergenic
948200800 2:236128516-236128538 GAACCCGAGGATGGGGAGAGAGG - Exonic
1172888938 20:38249901-38249923 GAGCCCAAGTCTCAGGAGAGAGG - Intronic
1172911671 20:38414034-38414056 GAATCAGAAACTCAGGGGAGGGG + Intergenic
1173547942 20:43914100-43914122 GAGCCCGAAGCTCTGAAGAGGGG - Intergenic
1174204099 20:48827159-48827181 AAACCTGAAGCTCAGAGGAGGGG - Intronic
1177916943 21:27100735-27100757 GGACATGAAGCTCAGGAGAGAGG + Intergenic
1178672099 21:34600498-34600520 GAAGGGGAAGATCAGGAGAGAGG + Intronic
1178855207 21:36245104-36245126 GTGCCCGAGCCTCAGGAGAGCGG + Exonic
1181455391 22:23057450-23057472 GAATCCAGAACTCAGGAGAGAGG + Intergenic
1182248774 22:28982963-28982985 GAATAAGGAGCTCAGGAGAGAGG + Intronic
1183365047 22:37402550-37402572 GAAACCGAGGCTCATGAGGGGGG + Intronic
1183692216 22:39396873-39396895 GAGCCAGAAGCCCAAGAGAGGGG - Intergenic
1184551224 22:45205177-45205199 GAAGGGGAAGCTAAGGAGAGAGG + Intronic
949943095 3:9169908-9169930 GAAACTGAGGCTCAGGAAAGGGG - Intronic
950837558 3:15935470-15935492 GACCCAGAAGTGCAGGAGAGAGG - Intergenic
951252990 3:20415977-20415999 GAATCCGAGGCGAAGGAGAGCGG + Intergenic
952653062 3:35749198-35749220 GAACCCCAAGCTCAGTAGGGAGG - Intronic
956471348 3:69570367-69570389 GAACCCAAAGCACAGGATGGTGG - Intergenic
960898802 3:122533407-122533429 GAACCTGCAGGTCAGGAGAGAGG + Intronic
961739645 3:129025132-129025154 GAGCCCGAGGTTCAAGAGAGAGG + Intronic
962677930 3:137770149-137770171 GAACCAGAAGCGCAGGAGCTGGG + Intergenic
963287392 3:143446435-143446457 GAACCTGTTGCTCAGCAGAGTGG + Intronic
965952619 3:174329332-174329354 GAACCCAAAGCGCAGGATAAAGG + Intergenic
966934934 3:184700062-184700084 GAACCCCAAGGTGAGAAGAGTGG + Intergenic
967170321 3:186818133-186818155 GCACAAGAAGCTGAGGAGAGAGG + Intergenic
969106587 4:4811189-4811211 GAATCTGCAGCTCAAGAGAGGGG - Intergenic
969215503 4:5719222-5719244 AAACCCGAAGGTCAGGAGTTGGG - Intronic
970502625 4:16693664-16693686 AAACCTGAAGCACAGCAGAGAGG + Intronic
970587361 4:17527270-17527292 GAACTCCAAGGTCATGAGAGAGG - Intergenic
977224210 4:94375198-94375220 AAGCCTGAAGTTCAGGAGAGTGG - Intergenic
979093859 4:116519821-116519843 GAACAGGAGGCTCAAGAGAGTGG - Intergenic
981054761 4:140349490-140349512 GAATCATAAACTCAGGAGAGAGG - Intronic
985836641 5:2276883-2276905 GTCCCTGAAGCTCATGAGAGGGG + Intergenic
986704766 5:10445969-10445991 GAACCCTAACCTGAGGAAAGAGG - Intronic
990633304 5:57694916-57694938 AAATCCGAAGCTCTGGAGTGTGG - Intergenic
991394053 5:66184921-66184943 GTGACTGAAGCTCAGGAGAGAGG - Intergenic
999243467 5:150140619-150140641 GAACCCCAAGTTCAGGGGAGAGG + Intronic
1000396992 5:160786497-160786519 GAAATAGAAGCTCAAGAGAGAGG + Intronic
1001410428 5:171507602-171507624 GGACCTGATGCTCAGGAGATGGG + Intergenic
1001848299 5:174940772-174940794 GTATCTGGAGCTCAGGAGAGAGG + Intergenic
1001952101 5:175823568-175823590 GAACCCCAAGTTCGGGAGAGAGG + Intronic
1002412166 5:179089575-179089597 AAACCCTCAGCTAAGGAGAGAGG - Intergenic
1002872220 6:1177273-1177295 GAGCCAGGAGCTCTGGAGAGGGG - Intergenic
1005285266 6:24319737-24319759 AAACCAGAATCTAAGGAGAGTGG + Intronic
1007467058 6:42059964-42059986 GAACCCGAAGGTGAGAAGAGTGG + Intronic
1009817151 6:68750985-68751007 GAAGACGAAGCCCAGAAGAGTGG - Intronic
1012176835 6:96097302-96097324 GCTCCCCAAGCTCAGAAGAGTGG + Intronic
1015106795 6:129546124-129546146 GAAGCTGAAGTTCAGGAGAGAGG - Intergenic
1016334144 6:142986065-142986087 GATCCTGAAGCACAGCAGAGGGG + Intergenic
1016386190 6:143533090-143533112 GGATCTGAAGCCCAGGAGAGAGG + Intergenic
1017077251 6:150630672-150630694 GAACCTGGTGCTCAGGAGAGGGG + Intronic
1019080935 6:169429134-169429156 GAACACGAGCCTCGGGAGAGAGG - Intergenic
1019812075 7:3172148-3172170 GAACGCCAAGCACAGGGGAGAGG + Intronic
1020151921 7:5689135-5689157 GAACCAAAAGCACAGGAGGGAGG + Intronic
1021621420 7:22553986-22554008 GAACCCGGAGCTCAGGGGCAGGG - Intronic
1023866696 7:44241815-44241837 GAGCCCGAGGCACAGGGGAGAGG + Intronic
1023968369 7:44975218-44975240 GGACCCGAGACTGAGGAGAGAGG + Exonic
1024603643 7:51008151-51008173 GAAACTGAAGCTCAGAAAAGAGG - Intergenic
1025869966 7:65422384-65422406 GAACCCCAAGCACAGCACAGTGG + Intergenic
1026974129 7:74486272-74486294 GAAACAGAGGCTTAGGAGAGAGG + Intronic
1027131146 7:75592251-75592273 GAACCCAAAGGCCAGGAGAAGGG + Intronic
1028274810 7:88841691-88841713 CAACCAAAAGCTCAGGAGGGAGG - Intronic
1028616562 7:92775000-92775022 CAACATGAAGTTCAGGAGAGGGG + Intronic
1030110578 7:106023234-106023256 GAATCCGAAGCTCTGGAGGTGGG + Intronic
1030837639 7:114309265-114309287 GAAACTGAAGCTCAGGAAACTGG + Intronic
1031453889 7:121956066-121956088 GAACCGGAAGTTCTGGCGAGAGG - Intronic
1031467264 7:122127871-122127893 GAGTCTGAAGCTCAGGAGGGCGG - Intronic
1034224437 7:149471775-149471797 GGACCAGAAGCACAGCAGAGAGG + Intergenic
1035298521 7:157881401-157881423 GCATCTGAAGCCCAGGAGAGAGG + Intronic
1035337504 7:158139250-158139272 GCACCCGCTGCTCAGCAGAGTGG + Intronic
1038177517 8:25194616-25194638 GATCCCGAAGCACAGGGAAGGGG - Intronic
1038464184 8:27744953-27744975 GAACCCAAAGCTCAGGTAATTGG - Intronic
1040423675 8:47263094-47263116 GAAACTGAGGCTCAGCAGAGAGG + Intronic
1040638359 8:49302153-49302175 GATCCAGAAGCTCAGGAGTCTGG - Intergenic
1042058858 8:64795478-64795500 GCACCAAAAGCTCAGGGGAGAGG - Intronic
1042950948 8:74200224-74200246 GAGCTGGAAGCCCAGGAGAGAGG - Intergenic
1045884164 8:107076603-107076625 GTACCTGAAGCTCAGAAGGGTGG - Intergenic
1046026242 8:108727645-108727667 GAGCCAGAAGCTCAGGAGGGAGG + Intronic
1046705058 8:117440493-117440515 GATTCTGAAGCTCAGGAGATGGG - Intergenic
1047437491 8:124847064-124847086 GAACCAGGAGCACAGGGGAGAGG + Intergenic
1047964585 8:130036470-130036492 TAACCCCAAACTCAGGAGACTGG - Intergenic
1048486199 8:134849993-134850015 GAATCAGAATCTCAGGTGAGGGG - Intergenic
1049544217 8:143221917-143221939 GAAACAGAGGCCCAGGAGAGGGG - Intergenic
1049909836 9:254905-254927 GAATCAGAATCTCAGGAGGGTGG + Intronic
1050042824 9:1513879-1513901 GGACAGGAAGCTCATGAGAGTGG - Intergenic
1050070294 9:1804205-1804227 GAGCCTGAAGCTCAGAAGAAAGG + Intergenic
1053162361 9:35822083-35822105 GGGTCTGAAGCTCAGGAGAGAGG - Intronic
1053451015 9:38194012-38194034 GAACCCCAAGCCAAGGAGTGTGG + Intergenic
1055485585 9:76753587-76753609 GGACCAGAATCTCAGGGGAGAGG - Intronic
1056132057 9:83596945-83596967 GAAGCCAAAGCTCTGGAGGGAGG + Intergenic
1059543208 9:115151193-115151215 GAACCAGAAACTCTGGAGATGGG + Intronic
1060040979 9:120300890-120300912 GATTCCTCAGCTCAGGAGAGGGG + Intergenic
1060743599 9:126115278-126115300 GAACAGGAACCTCAGCAGAGCGG + Intergenic
1061105907 9:128530197-128530219 GAATCTGAAGCTCAGAAGAAAGG - Intronic
1061329213 9:129881643-129881665 GAACCCCAGGCTCAGCAGGGAGG - Exonic
1061625479 9:131838558-131838580 GAACCAGAGGCTGAGGAGTGGGG - Intergenic
1062153435 9:135033154-135033176 GAACCGGCAGCGCAGGCGAGAGG + Intergenic
1062237399 9:135516909-135516931 GTACCTGCAGCTCAGGAGAAAGG - Intergenic
1189800967 X:44691625-44691647 CATCCACAAGCTCAGGAGAGAGG - Intergenic
1192158909 X:68768369-68768391 GAAACTGAGGCTCAGAAGAGAGG - Intergenic
1195048401 X:101075831-101075853 GAACCCCAAGGTGAGAAGAGTGG - Intergenic
1195366922 X:104135323-104135345 GAAACCAAAACTCAGGAAAGAGG - Intronic
1195669190 X:107454883-107454905 GAATCAGAAGCTCAGGAGGTAGG - Intergenic
1196777290 X:119350907-119350929 GAATCTGGAGTTCAGGAGAGAGG + Intergenic
1197450601 X:126610476-126610498 GAAACTTAAGCTCAGCAGAGAGG - Intergenic
1197887680 X:131235398-131235420 GAACCAGGAGCTCAGGAGTTAGG + Intergenic
1198033947 X:132782671-132782693 AAGCCTGAAGCTTAGGAGAGAGG + Intronic
1198175327 X:134149049-134149071 GAGCCTGAAGCTCAGGAGAGAGG - Intergenic
1198763354 X:140057202-140057224 GAACTCGAAGCTGAAGAGTGTGG + Intergenic
1199065103 X:143406889-143406911 GAATCTGAAGTTCAGAAGAGAGG - Intergenic
1199448738 X:147956242-147956264 GAACCCAAAGCTCAAAGGAGGGG + Intergenic
1200809941 Y:7473746-7473768 CAACTCCAAGCCCAGGAGAGAGG - Intergenic