ID: 1077910877

View in Genome Browser
Species Human (GRCh38)
Location 11:6570553-6570575
Sequence TACTCTCTCGAGTCTAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 46}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077910877 Original CRISPR TACTCTCTCGAGTCTAGGGT GGG Intronic