ID: 1077910877

View in Genome Browser
Species Human (GRCh38)
Location 11:6570553-6570575
Sequence TACTCTCTCGAGTCTAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 46}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077910877 Original CRISPR TACTCTCTCGAGTCTAGGGT GGG Intronic
912730873 1:112102277-112102299 TTCTCTCACTAGTCAAGGGTTGG - Intergenic
915162496 1:153930263-153930285 TTCCCTCTCCAGCCTAGGGTGGG - Exonic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1081074704 11:38656538-38656560 TACTCTCTACACTCTAGAGTAGG + Intergenic
1083669974 11:64294211-64294233 CACTTTCTTGAGTCTATGGTTGG - Intronic
1086171469 11:83841465-83841487 TAGTCTCTCTACTCTAGGCTGGG + Intronic
1086606785 11:88705158-88705180 TACTCTGTCCAGTGTGGGGTTGG + Intronic
1087291583 11:96326499-96326521 AACTATCTCGAGTTTAGGCTGGG + Intronic
1089029812 11:115313915-115313937 TTCACTCACTAGTCTAGGGTGGG - Intronic
1092847408 12:12596589-12596611 TCCTCTCTCTCCTCTAGGGTAGG + Intergenic
1104141887 12:125995371-125995393 TATGCTCAGGAGTCTAGGGTGGG - Intergenic
1104926620 12:132317217-132317239 TGCTCTGTGGAGTCTAGGATGGG - Intronic
1106273119 13:28173757-28173779 TTCTCTTTAGAGTTTAGGGTAGG - Intronic
1120094874 14:80377059-80377081 TACTTTCTCCACTCTAGGGGAGG + Intronic
1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG + Intronic
1130929828 15:88416095-88416117 GAGTCTCTTGAGTCTAGGCTGGG - Intergenic
1135063911 16:19293214-19293236 TACTCTCTCTAGTATTGGCTGGG - Intronic
1151248179 17:72812394-72812416 TAGAATCTAGAGTCTAGGGTTGG + Intronic
1154486788 18:14878448-14878470 TTCTTTCTCGATTCTAAGGTTGG + Intergenic
1160001882 18:75032510-75032532 TCTTCTCTCGACTCTAAGGTAGG + Intronic
1163217486 19:15891779-15891801 TTCTCTCACGTGTCTAGGTTTGG - Intronic
927613988 2:24571122-24571144 TACTATCTCGAGTACAGGGGAGG + Intronic
931645034 2:64414439-64414461 CACTCTCTTAAGTTTAGGGTGGG + Intergenic
932092322 2:68817486-68817508 TCCTCTCTGGAGACTTGGGTGGG + Intronic
946115293 2:217456061-217456083 TACTCTCTCAAGTCTATGTTGGG + Intronic
1173407427 20:42778714-42778736 GACTCCCACGAGTCCAGGGTGGG + Intronic
1176794511 21:13360950-13360972 TTCTTTCTCGATTCTAAGGTTGG - Intergenic
957577844 3:82032250-82032272 TACTCCCTCAAGTCTATGGGTGG + Intergenic
959102672 3:102030920-102030942 TACTCTTTCTATTTTAGGGTAGG + Intergenic
960747625 3:120908026-120908048 TACCCTATCGAATCTAGGATTGG + Intergenic
970487085 4:16535581-16535603 TACTCAATCCAGACTAGGGTGGG + Intronic
971137824 4:23889040-23889062 TAATCTCTGGAGTCTAGTGGGGG - Intronic
984289251 4:177772520-177772542 TACTCTTACGAGTCTAGGGCAGG - Intronic
984744681 4:183202811-183202833 TGCTCTCTGGAGTCAAGGCTGGG + Intronic
989169772 5:38462602-38462624 TCCTCTCTCTAGTCTAAGTTAGG + Intronic
989380133 5:40802358-40802380 TACTCTCTCGAGGCTGAAGTAGG - Intergenic
994298594 5:98119930-98119952 TGCTCTCTCGATTCTAGCCTTGG - Intergenic
997926337 5:138033571-138033593 TTCTCTCTGGAGTCTAGGTCAGG - Intronic
1012651221 6:101755526-101755548 AACTCTCTAGAGTCTAGACTAGG - Intronic
1013054491 6:106570222-106570244 TCTTCTCTGGAGTCTATGGTAGG + Exonic
1027585532 7:80053724-80053746 TACTTTCTTGAGACTAGGCTGGG + Intergenic
1032143038 7:129351448-129351470 TTCTCTCTTGAGTGTAGAGTGGG - Intronic
1038523913 8:28257119-28257141 TCCTCTCTCGGGTTTAGAGTGGG + Intergenic
1053887723 9:42657223-42657245 TTCTTTCTCGATTCTAAGGTTGG + Intergenic
1054226743 9:62464673-62464695 TTCTTTCTCGATTCTAAGGTTGG + Intergenic
1059809103 9:117836212-117836234 AACTCTCTCTAGTCTCTGGTTGG + Intergenic
1195341638 X:103912336-103912358 TGCTCTCTCGCGTGTATGGTGGG + Intergenic
1195779464 X:108445240-108445262 TACTCCCTCCAGTCTAGCCTAGG + Intronic
1199466588 X:148144831-148144853 GACTCTCTGGAGTCAAGGGCTGG - Intergenic
1201020115 Y:9647546-9647568 TTCTCTCTCTAATCTAGGCTAGG - Intergenic