ID: 1077911618

View in Genome Browser
Species Human (GRCh38)
Location 11:6576965-6576987
Sequence AAGCTGTTCTGTAGCACGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077911615_1077911618 -2 Left 1077911615 11:6576944-6576966 CCCTACTGGAACTGTGGAAGGAA 0: 1
1: 0
2: 2
3: 13
4: 183
Right 1077911618 11:6576965-6576987 AAGCTGTTCTGTAGCACGGATGG 0: 1
1: 0
2: 0
3: 6
4: 115
1077911610_1077911618 25 Left 1077911610 11:6576917-6576939 CCAAGGGCAAAGAGGCTTTTGCC 0: 1
1: 0
2: 2
3: 11
4: 171
Right 1077911618 11:6576965-6576987 AAGCTGTTCTGTAGCACGGATGG 0: 1
1: 0
2: 0
3: 6
4: 115
1077911612_1077911618 4 Left 1077911612 11:6576938-6576960 CCTTTTCCCTACTGGAACTGTGG 0: 1
1: 0
2: 0
3: 5
4: 152
Right 1077911618 11:6576965-6576987 AAGCTGTTCTGTAGCACGGATGG 0: 1
1: 0
2: 0
3: 6
4: 115
1077911616_1077911618 -3 Left 1077911616 11:6576945-6576967 CCTACTGGAACTGTGGAAGGAAG 0: 1
1: 0
2: 1
3: 23
4: 311
Right 1077911618 11:6576965-6576987 AAGCTGTTCTGTAGCACGGATGG 0: 1
1: 0
2: 0
3: 6
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077911618 Original CRISPR AAGCTGTTCTGTAGCACGGA TGG Intronic
903327299 1:22576787-22576809 AAGATGTACTGCAGCGCGGAGGG + Exonic
904875524 1:33651878-33651900 GAGCTTTTCTGTAGCAGGAATGG + Intronic
906136777 1:43505590-43505612 CAGCTCTTCTCTAGCATGGATGG - Intergenic
906250376 1:44306552-44306574 GACCTGTTCTGTAGCACAGTGGG - Intronic
912176703 1:107167190-107167212 GATCTGTTCTGTAACACTGAGGG - Intronic
913111875 1:115664322-115664344 CAGCTGCTCTGTAGCACGTGAGG + Intronic
913546247 1:119871701-119871723 AAGCTGTTTTGTAGAAAGAAAGG - Intergenic
916895593 1:169158814-169158836 CAGCTGTTCTGGAGCAGGGGAGG + Intronic
919923627 1:202180727-202180749 GAGCTGTTCTAGAGCCCGGATGG - Intergenic
1074285899 10:112098078-112098100 AAGCTGTGCTGTATCTTGGAAGG + Intergenic
1074430478 10:113390057-113390079 AATCTGTTCTGCAGCAGGGAAGG - Intergenic
1077911618 11:6576965-6576987 AAGCTGTTCTGTAGCACGGATGG + Intronic
1082767329 11:57180186-57180208 AATCTGTTCTGAAGCAAGCAAGG + Intergenic
1083870829 11:65487587-65487609 AAGCTGTTCTGAACCAGAGAAGG - Intergenic
1088141730 11:106624800-106624822 AAGCTATAGTGTAGCACAGATGG + Intergenic
1091789620 12:3264298-3264320 AAGCTGTTCTGTGACCCAGAAGG - Intronic
1105097612 13:16397713-16397735 AAACTGTTCTGTCGAAAGGAAGG - Intergenic
1105179021 13:17714786-17714808 AAGCTGCTCTGTAAAAAGGAAGG - Intergenic
1108439852 13:50440063-50440085 AAGCTGTTCTTTAAGAAGGAAGG - Intronic
1118641413 14:67796143-67796165 CTGCTGTTCTGTAGCACTGCAGG + Intronic
1121728505 14:96170319-96170341 AAGGTGTTCTGTACCAGGCAAGG - Intergenic
1123305830 15:18420962-18420984 AAGCTGCTCTGTAGAAAGAAAGG - Intergenic
1123314801 15:18570424-18570446 AAGCTGCTCTGTAGAAAGAAAGG - Intergenic
1123326665 15:18767488-18767510 AAGCTGCTCTGTAGAAAGAAAGG - Intergenic
1123344223 15:19058739-19058761 AAGCTGTTCTGTAAAAAGAAAGG - Intergenic
1123344337 15:19060616-19060638 AAGCTGCTCTGTAAAAAGGAAGG - Intergenic
1123348142 15:19123683-19123705 AAGCTGCTCTGTAAAAAGGAAGG - Intergenic
1123348704 15:19133061-19133083 AAGCTGCTCTGTAGAAAGAAAGG - Intergenic
1123355405 15:19244376-19244398 AAGCTGCTCTGTAGAAAGAAAGG - Intergenic
1123364155 15:19389682-19389704 AAGCTGCTCTGTAGAAAGAAAGG - Intergenic
1123370492 15:19494227-19494249 AAGCTGTTCTGTAAAAAGAAAGG - Intergenic
1123384295 15:19724798-19724820 AAGCTGTTCTGTAAAAAGAAAGG - Intergenic
1125339463 15:38660666-38660688 GAGATGTTCTGTACCACGGAAGG - Intergenic
1131889588 15:96958107-96958129 AAGAAGTGCTGTAGCACTGAAGG + Intergenic
1132474803 16:129247-129269 AAGCTGATCTGTGGCACAGGTGG + Intronic
1133883228 16:9802889-9802911 TAGCTGTTCTGTGGCAAGCAAGG + Intronic
1134531629 16:14988722-14988744 TAGCTGTTCTGCAGCACGTCGGG + Intronic
1135902091 16:26470271-26470293 AAGCTGCACTGTAGCACAAATGG + Intergenic
1137575290 16:49595436-49595458 AAGCTGGTCTGTGGCTGGGAAGG - Intronic
1137724139 16:50645770-50645792 AAGATGTTCGGCAGCACGGAAGG - Intergenic
1142285739 16:89170840-89170862 AAGGAGTTCTGTAGGAAGGAAGG + Intergenic
1149677756 17:58481540-58481562 AAGCTAATCTGTAAAACGGAGGG + Intronic
1150441161 17:65192648-65192670 ATAGTGTTCTGTAGCACTGAAGG + Intronic
1152546198 17:81001166-81001188 TGGCTGTGCTGTAGCAGGGATGG - Intronic
1155202879 18:23532985-23533007 AAGCTGTTCTGCAGCACTGCTGG + Intronic
1157481086 18:48054254-48054276 AAGCAGTCCTGGAGCAGGGAGGG + Intronic
1158543942 18:58379816-58379838 ATGCATTTCTGTACCACGGAGGG + Intronic
1158940296 18:62401377-62401399 AAGCTTTTCTTCAGCAGGGATGG - Intergenic
1160503521 18:79414330-79414352 CAGCAGTTCTGTACCACGGTGGG - Intronic
1161480433 19:4507736-4507758 AAGCTGTTGTGCAGCCCGGGAGG - Intronic
1166903097 19:46081744-46081766 CAGCAGTTCTGCAGCACTGAGGG - Intergenic
927004284 2:18831958-18831980 ATGCTGTGCTATAGCACAGAAGG - Intergenic
928114475 2:28537257-28537279 GAGCTGTTCTGTTTCCCGGAGGG - Intronic
932720142 2:74132775-74132797 AAGCTGATCTGTAGAGAGGAAGG + Intronic
934625264 2:95843026-95843048 AAGCTGTCCTGTAGAAATGAGGG + Intronic
934781411 2:96971929-96971951 AAGCTGTTCTGGAACACGTCAGG - Exonic
934808308 2:97258273-97258295 AAGCTGTCCTGTAGAAATGAGGG - Intronic
934829201 2:97498913-97498935 AAGCTGTCCTGTAGAAATGAGGG + Intronic
935186035 2:100733848-100733870 AAGCAGCTCTGTTGCAAGGAGGG + Intergenic
936546936 2:113399811-113399833 AAGCTGTCCTGTAGAAATGAGGG - Intergenic
939573919 2:143873565-143873587 AGGCTGTTCCATAGCAAGGAGGG + Intergenic
1169614677 20:7427311-7427333 CAGCTGTTCTGTATCACCCATGG + Intergenic
1169884675 20:10385652-10385674 AATATGTTCTTTAGCAGGGAAGG + Intergenic
1175522556 20:59611516-59611538 AAGCTGTTCTGCGTCACTGAGGG - Intronic
1179609195 21:42538597-42538619 AAGCTGTAGAGTATCACGGATGG - Intronic
1181028011 22:20136766-20136788 AACCTGTTCTGGTGCACAGAAGG - Intronic
1184725968 22:46346644-46346666 AAGCTACTCTGGAGCACAGAGGG - Intronic
1184916517 22:47572749-47572771 AAGCTGTCCAGGAGCTCGGATGG - Intergenic
1185398173 22:50603208-50603230 AGGCTGTCCTGCAGGACGGAGGG - Exonic
949477419 3:4461938-4461960 AAGCTGTGGTGTGGCAGGGAAGG - Intronic
952081188 3:29759433-29759455 AAGCTGTTCTGAGGGACGCAAGG + Intronic
958221218 3:90683554-90683576 AAACTGTTCTATAGAAAGGAAGG + Intergenic
958222427 3:90708939-90708961 AAACTGCTCTGTAGAAAGGAAGG + Intergenic
959461345 3:106629604-106629626 CAGCTGTTCTGTCTCAGGGAAGG - Intergenic
960275137 3:115720587-115720609 AAGCTGTTCAGTGGCACCTATGG - Intronic
960286285 3:115832685-115832707 AAGCTGTTCATTAAGACGGATGG - Intronic
963056094 3:141187508-141187530 AAGCTGTTCAGGAGCTGGGAAGG - Intergenic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
965073609 3:163948054-163948076 AAGCAGTTCTGTATCACCGTTGG + Intergenic
966259596 3:177960049-177960071 AAGCTGTTTTGTAGCAATGCTGG - Intergenic
969095951 4:4732955-4732977 TAGCTATTCTGTAGCTCTGAGGG + Intergenic
974714132 4:65644390-65644412 AAGTTGTTCTGTTGCACAGGAGG - Intronic
974897205 4:67953824-67953846 AAACTGTTCTGTGGAACAGAAGG - Intronic
976228037 4:82812244-82812266 CTGCTGTTCTCTAGCAGGGAGGG + Intergenic
979801225 4:124911991-124912013 AAGCTGTTCTTTAGAAATGAAGG - Intergenic
983280291 4:165672471-165672493 AAGCTACTCTGTACCAAGGAAGG + Intergenic
984499081 4:180535625-180535647 AGCCAGTTCTGTAGCAGGGATGG + Intergenic
984749594 4:183259034-183259056 GAGATGTGCTGTAGCTCGGAAGG + Intronic
986992573 5:13571210-13571232 AAGCTGTGCAGCAGGACGGAAGG + Intergenic
992169922 5:74091526-74091548 CTGGTGTTCTGTAGCACAGATGG - Intergenic
996000577 5:118357383-118357405 AAGCTGTCCTGTAGATCAGAAGG - Intergenic
999344851 5:150808049-150808071 AAACTGTTCTGTATCACAGAAGG - Intergenic
999495559 5:152093252-152093274 AAGATGTCCTGTAGCAAAGAGGG - Intergenic
999849973 5:155527437-155527459 AAGCTGTTATGTGGCACACAAGG - Intergenic
1002829195 6:803787-803809 AAGCTGTGCTGTGGCGCGGCGGG - Intergenic
1003480521 6:6527550-6527572 AATTTGTTCTGTAGCAGAGATGG + Intergenic
1003991094 6:11487305-11487327 AAGCTATTCTGTAGGGCAGAGGG + Intergenic
1010372582 6:75128704-75128726 AAGGTGTTCTGAAGCACACATGG - Intronic
1013607285 6:111762018-111762040 AAGCTGTTCCTTCTCACGGAAGG - Intronic
1013697285 6:112718712-112718734 CTGCTGTTCTATAGCACTGAAGG - Intergenic
1015248521 6:131102576-131102598 AAGCTGTTCTGTAGTTCTGAGGG - Intergenic
1015757549 6:136622803-136622825 AAGCTGTTCTGTAGTACTTTGGG - Intronic
1018244946 6:161813741-161813763 AAGAGGATCTGTAGCAGGGAAGG - Intronic
1018759261 6:166876688-166876710 AAGCTGCTCTGTGGCTCCGAAGG + Intronic
1020756409 7:12209420-12209442 AAGCAGTTCAGTAGCAGGGTTGG - Intergenic
1026806266 7:73431051-73431073 GAGCTGTGCTGGAGCAGGGAGGG - Intergenic
1028158731 7:87461965-87461987 AAGCTTTACTGTTGCACAGATGG - Intronic
1034119368 7:148613060-148613082 CTGCTGTTCTGTAGCACAGTAGG - Intronic
1034180325 7:149132484-149132506 AAGCTGTTCTCTAGGCCGGGCGG - Intronic
1034818481 7:154195537-154195559 ATGCTCTTCTGTGGCACTGATGG + Intronic
1034856833 7:154557760-154557782 ATGCTGTACTGCAGCACGAAGGG + Intronic
1035046797 7:155973173-155973195 AAGATGTTCAGGAGCAGGGAAGG - Intergenic
1043858386 8:85287747-85287769 AATCTGTTCTGTATCACAAAGGG - Intergenic
1044024191 8:87148537-87148559 AGGCTGTTCTGTGGCAGAGAAGG + Intronic
1045064367 8:98432523-98432545 AAGCTGATTTGTAGCTCGTAAGG + Exonic
1046767989 8:118090896-118090918 AAGCTGTTTTGTACCACAGGTGG + Intronic
1049927503 9:423791-423813 AAGCAATTCTGTAGCACCCACGG - Intronic
1055761117 9:79609381-79609403 AAGGTTTTCTTTAGCAGGGATGG + Intronic
1185547901 X:960614-960636 AAGCTTTTCTCTTGCAGGGAAGG + Intergenic
1194980634 X:100436777-100436799 GAGCTGTTCTGTTACACGTAAGG - Intergenic
1200337471 X:155365427-155365449 TAGGTGTTGTGTAGCAAGGAGGG - Intergenic
1200348999 X:155475800-155475822 TAGGTGTTGTGTAGCAAGGAGGG + Intergenic