ID: 1077911879

View in Genome Browser
Species Human (GRCh38)
Location 11:6579595-6579617
Sequence AAGGAGAGCAGAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 708
Summary {0: 1, 1: 6, 2: 49, 3: 147, 4: 505}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077911875_1077911879 14 Left 1077911875 11:6579558-6579580 CCAGGTGGCACACAGAGAGAATC 0: 1
1: 1
2: 10
3: 46
4: 241
Right 1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG 0: 1
1: 6
2: 49
3: 147
4: 505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077911879 Original CRISPR AAGGAGAGCAGAGTGATTGT GGG Intronic
900907921 1:5573820-5573842 TAGGAGAGCAGGGTGATAATAGG + Intergenic
900958388 1:5902879-5902901 AAGCAGTTCAGAGTGGTTGTAGG + Intronic
901248695 1:7755498-7755520 AAGAAAAGGAGAGTGATGGTGGG - Intronic
901945666 1:12701645-12701667 CAGGAGAGCCGAGTGATTTGGGG + Intergenic
901955878 1:12785167-12785189 CAGGAGAGCAGGGTGATAGTGGG + Intergenic
901978294 1:13012664-13012686 CAGGAGAGCAGGGTGATAGAGGG + Intronic
901979251 1:13021215-13021237 CAGGAGAGCAGGGTGATAGTGGG + Intronic
902002831 1:13207723-13207745 CAGGAGAGCAGGGTGATAGTGGG - Intergenic
902003790 1:13216274-13216296 CAGGAGAGCAGGGTGATAGAGGG - Intergenic
902022059 1:13353487-13353509 CAGGAGAGCAGGGTGATAGTGGG - Intergenic
902023015 1:13362018-13362040 CAGGAGAACAGGGTGATAGTGGG - Intergenic
902075629 1:13782582-13782604 AAGCTGAGCAGAATGATTCTTGG - Exonic
902157696 1:14502950-14502972 CAGGAGAGAAGAATGATTGTGGG - Intergenic
904395754 1:30220430-30220452 AAAGAGAGCAGAGGAATTCTGGG + Intergenic
904659473 1:32073589-32073611 AAAGAGAGGAGAGTGGGTGTGGG + Intronic
905380766 1:37559890-37559912 CAGGAGAGCAGGGTGATAGTGGG + Intronic
905404627 1:37724552-37724574 AAGGAGAGCAGAGGGAAACTGGG + Intronic
905410656 1:37765763-37765785 AAGGAGAGCAAAGTGAGGGACGG + Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908022732 1:59915127-59915149 CAGGAGAGCAGAGTGATAGTGGG - Intronic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
908238715 1:62171193-62171215 TAGGAGAGCAGGGTGATAATAGG + Intergenic
908429112 1:64038461-64038483 AAGGAAAGCAGAGCTATTCTAGG - Intronic
908587707 1:65590555-65590577 AAGAAGTACAGAGTGAATGTGGG - Intronic
908794099 1:67814316-67814338 AAGAAGTTCAGAGTGAATGTTGG - Intronic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910089910 1:83450105-83450127 AAGCAGAGGAGAGTGATTCCAGG - Intergenic
910314637 1:85868427-85868449 AAGGAGGTCAGAGTGTGTGTAGG + Intronic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910476836 1:87616518-87616540 TGGGAGAGCAGAGTGATTATAGG + Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
912134700 1:106646545-106646567 ATTGAGAGCAGAGTGGATGTTGG + Intergenic
912230564 1:107787950-107787972 AAGGAGAGGAGTGGGATTGTGGG - Intronic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912642608 1:111361634-111361656 CAGGAGAACAGGGTGATAGTGGG + Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
913203317 1:116513639-116513661 AAGGAGCCCAGAGTGCTTCTGGG - Intergenic
913659394 1:120993181-120993203 AAGGAGAAGAGAGGGATTCTGGG - Intergenic
914861922 1:151393650-151393672 AAGGAGAGAAGAAAGATTATTGG + Intergenic
914924581 1:151873258-151873280 CAGGAGAACAGGGTGATAGTGGG - Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
916527077 1:165620511-165620533 AAGGAGGTCAGAGGGACTGTTGG + Intergenic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918083837 1:181228430-181228452 AAGGAGAGGAGAGTGGATGCTGG - Intergenic
918347638 1:183619490-183619512 AAGCAGAGGAGACTGATTATTGG + Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918402634 1:184178720-184178742 AAGGAGATCAGAGGGATTGTTGG - Intergenic
918637743 1:186798722-186798744 AAGAAGAGGAGATTTATTGTGGG - Intergenic
919001633 1:191839191-191839213 AGGGAGAGGAGAGCGATGGTGGG + Intergenic
919098785 1:193068186-193068208 AAGGAGAGCACCATGATTATTGG + Intronic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919342898 1:196336497-196336519 AAGGAAGGCAGAGAGATTGAGGG - Intronic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
919482567 1:198108010-198108032 TAGGAGAGCAGAGTGGTTTCAGG + Intergenic
919484469 1:198129901-198129923 CAGGAGAGCAGGGTGATAATGGG + Intergenic
919713319 1:200750118-200750140 GCGGGGAGCAGAGTGAATGTGGG + Intronic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
921580252 1:216888187-216888209 AATTAGAGGAGAGTGACTGTCGG - Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
922474345 1:225897022-225897044 TAGGAGGGCAGAGTGTTGGTGGG - Intronic
923018826 1:230147400-230147422 AAGGACAGCAAAGTGAATATAGG - Intronic
923440277 1:234012029-234012051 TAGGAGAGCAGGGTGATAATAGG + Intronic
923936132 1:238762508-238762530 CAGGAGAACAGGGTGATAGTGGG + Intergenic
924356069 1:243177542-243177564 AAGGAGAGCAGGGTCTCTGTTGG + Intronic
1062831604 10:609209-609231 AAGGAGAGCAGAGGTATTGGTGG - Intronic
1064389094 10:14925998-14926020 AAGAAGTGCAGAGTGAAAGTGGG - Intronic
1064891656 10:20181879-20181901 ATGGAGAACAGAGTTTTTGTTGG + Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1066228368 10:33407190-33407212 AAGGAGAACTGAGTGAGTGTGGG + Intergenic
1066556906 10:36624241-36624263 AAGTAGAGTAGAGAGATTGGGGG - Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067143604 10:43677075-43677097 GAGGGGTGCAGAGTGCTTGTTGG + Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1067411743 10:46070679-46070701 AAGGAGAGCAGAGGGAAAGCTGG + Intergenic
1067669104 10:48303508-48303530 AAGGAGAGAAGAGGAACTGTAGG - Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069734889 10:70647569-70647591 AAGGAGAGCACTGTGCATGTGGG - Intergenic
1069862698 10:71481396-71481418 AAGGAGAGGTGTGTGATGGTGGG + Intronic
1070493742 10:77001715-77001737 AAAAAATGCAGAGTGATTGTTGG + Intronic
1071185544 10:83039883-83039905 AAAGAGAGCAAATAGATTGTAGG + Intergenic
1071798265 10:89029151-89029173 AAGAGGAGCAGAGAGATTGGAGG + Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072710416 10:97712824-97712846 AAGGAGAGAAGAGAGACTGGTGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075038756 10:119090970-119090992 AAGGAGAGGAGCATGTTTGTGGG + Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075619655 10:123916447-123916469 AAGGAGCACAGAGTGAATGGGGG - Intronic
1075890005 10:125940300-125940322 CAGGAGAACAGGGTGATAGTGGG + Intronic
1075904743 10:126071486-126071508 AAGGAGAGGAGTGTGACTGTGGG - Exonic
1076376709 10:129993146-129993168 AAGGAAAGCACGGTGATTGTGGG + Intergenic
1077703219 11:4460685-4460707 CAGGAGAGCAGGGTGATAGTGGG + Intergenic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078182384 11:9022920-9022942 AAGGAGAGAAGAGTCTTTCTTGG - Intronic
1078601528 11:12735688-12735710 ATGGGGAGCAGAGTGGTGGTGGG - Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1078931581 11:15916013-15916035 AAGGAGAGGAGAGTGGATTTTGG - Intergenic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1082724548 11:56719441-56719463 TAGGAGAGCAGGGTGATAATAGG - Intergenic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1082969594 11:59005484-59005506 CAGGAGAACAGGGTGATAGTGGG - Intronic
1083375467 11:62216701-62216723 TAGGAGAGCAGGGTGATAGTGGG - Intergenic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1083797130 11:65023417-65023439 TAGGAGAGCAGGGTGATAATAGG + Intronic
1084799762 11:71535455-71535477 CAGGAGAGCAGGGTGATAGTGGG - Intronic
1086261619 11:84947019-84947041 AGGGAGAGCAAAGTGATGGCTGG - Intronic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087104412 11:94395838-94395860 AAGGAGAGAGGAGTAATTGCAGG - Intronic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089474842 11:118751004-118751026 AAGGGGATTAGAGTGATTATGGG - Exonic
1090069099 11:123527935-123527957 AAGGAGAGCAGTGTTAATCTGGG + Intronic
1090292298 11:125555928-125555950 AAGGAGAGCACTGTGCATGTGGG - Intergenic
1090491279 11:127162978-127163000 AAGGAGCAGCGAGTGATTGTAGG - Intergenic
1090648860 11:128789141-128789163 AAGGAAACCAGCGTGTTTGTTGG + Intronic
1090975167 11:131673750-131673772 AAGGAGAGCCGAGAGAGTGGAGG - Intronic
1091013779 11:132030783-132030805 GATGAGAGCAGAGAGATAGTGGG + Intronic
1092229791 12:6770044-6770066 AAGGAGAGCAGAGTCAGGGTGGG + Intronic
1092347055 12:7724118-7724140 AAGGAGCGCAGGGTGATGCTAGG + Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094795742 12:33970272-33970294 AAGGAAAACAAAGTGATTGAGGG - Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095196362 12:39323266-39323288 CAGGAGAGCACAGTAAATGTTGG - Intronic
1095450963 12:42329996-42330018 CAGGAGAACAGGGTGATAGTGGG + Intronic
1095456183 12:42388474-42388496 TAGGAGAGCAGGGTGATAATAGG - Intronic
1095625001 12:44304194-44304216 GAGGAGAGCACAGTGACTATGGG + Intronic
1096749354 12:53748821-53748843 AAGGAAATGAGAGTGATGGTGGG + Intergenic
1097149880 12:56968814-56968836 CAGGAGAACAGGGTGATGGTGGG + Intergenic
1097371047 12:58781717-58781739 AAACAGAGCAGAGTGTTTTTGGG - Intronic
1097744074 12:63280467-63280489 AAGGAAGGAAGAGAGATTGTGGG + Intergenic
1097809587 12:64003747-64003769 AAGGAGAGGAGAAAGAGTGTGGG + Intronic
1098400104 12:70066111-70066133 AATGAGGGCAGAATGATTTTGGG + Intergenic
1098602892 12:72354317-72354339 AAGGAGAGAAGAGTGGTCTTGGG + Intronic
1098953220 12:76663231-76663253 AAGGAAAGAAGACTGGTTGTGGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1100722445 12:97373250-97373272 TATGAGATCAGAGAGATTGTAGG + Intergenic
1101252100 12:102946556-102946578 AGGGACAGCAAAGGGATTGTGGG - Intronic
1101699359 12:107157463-107157485 AGAGAGAGAAGAGTGATTCTTGG + Intergenic
1106003728 13:25749476-25749498 AAGCAGAGCAGTGGGAATGTGGG + Intronic
1106576284 13:30978873-30978895 AAAGAGAGCAGAGAGATGATGGG - Intergenic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108972926 13:56400619-56400641 AAGGAGATCACAATGATTGTGGG + Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110710691 13:78647553-78647575 TAGGAGAGCAGGGTGATAGTGGG - Intronic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111296012 13:86278664-86278686 AAGGAGATTAGAGTGATTATAGG + Intergenic
1111351813 13:87041235-87041257 AAGGAGAGCACTGTGCATGTGGG - Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112241539 13:97686769-97686791 AAGGTGAGAAGAGAGATTGCTGG - Intergenic
1112643656 13:101305618-101305640 AAGGAGACAAGAGGTATTGTTGG - Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113514483 13:110882277-110882299 AAGGAGAGCAGCCTGACTTTTGG + Intronic
1114604040 14:23981711-23981733 CAGAAGAGCAGGGTGATAGTGGG + Intronic
1114609060 14:24024510-24024532 CAGAAGAGCAGGGTGATAGTGGG + Intergenic
1114928793 14:27440749-27440771 AAGGAGAGGAGAGAAATGGTAGG + Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116131428 14:40859413-40859435 AAAGAGGGCAGAGTGATGATGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116481341 14:45394335-45394357 CAGGAGAACAGAGTGATGGTGGG - Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117229728 14:53703957-53703979 AAGGAGAACAGTGTTATTTTGGG + Intergenic
1117976066 14:61298078-61298100 AAGGGGAACAAAGAGATTGTTGG - Intronic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118806308 14:69240155-69240177 AGGGAGAGGAGAGTGTGTGTGGG + Intronic
1119475745 14:74926659-74926681 AAGCAGAGCAGAGGGAATGAGGG - Intergenic
1119575067 14:75712585-75712607 AAGGAAAGCAGAGAGTTAGTGGG - Intronic
1119647622 14:76359721-76359743 AGGGAAAGCAGAGGGCTTGTGGG + Intronic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1121295698 14:92820199-92820221 TAGGAGAGCAGGGCGATAGTGGG + Intronic
1121506664 14:94482971-94482993 TAGGAGAGCAGGGCGATAGTGGG - Intergenic
1121509069 14:94498941-94498963 AAGGAGAGGAGAGTGATAGAGGG + Intronic
1121555092 14:94830422-94830444 AAGGAGAGCAGAGAGACTGGGGG - Intergenic
1121673168 14:95729329-95729351 CAGGAGAACAGGGTGATAGTGGG + Intergenic
1122309947 14:100788148-100788170 AATGAGAGCAGAGTGTGTCTCGG + Intergenic
1122329115 14:100901163-100901185 AAGGAGGGCAGAGTCATTCAAGG - Intergenic
1122997656 14:105274235-105274257 CAGGAGAGCAGGGTGATAGTGGG - Intronic
1123136409 14:106031449-106031471 TAGGAGAGTAGGGTGATAGTGGG + Intergenic
1124582594 15:30973289-30973311 TAGCAGAGTAGAGTGGTTGTAGG - Intronic
1125611842 15:40976641-40976663 CAGGAGAGCAGAGGCCTTGTGGG + Intergenic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127140270 15:55969129-55969151 ACGAAGGGCAAAGTGATTGTGGG + Intronic
1127545669 15:59992951-59992973 AAGGAGGGCTGAGTGAGTGGGGG + Intergenic
1128789397 15:70422141-70422163 AAGGAGGGCAGAGTGGATGTTGG + Intergenic
1128921509 15:71614526-71614548 AAGGAGAGAAGAGTAAATTTTGG + Intronic
1129872133 15:78947322-78947344 CAGGAGAGGAGAGAGACTGTGGG - Intronic
1130275806 15:82475842-82475864 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1130383280 15:83390406-83390428 AAGGAGGGAAGCGTGATAGTGGG - Intergenic
1130468165 15:84203234-84203256 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1130496099 15:84470308-84470330 AAGGAGACCACAGTGCTTGCTGG - Intergenic
1130515745 15:84624602-84624624 AGGGAGCGCAGAGAGTTTGTTGG - Intronic
1130590458 15:85207832-85207854 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1130963065 15:88677487-88677509 GATGAGAGCAGAGTGAATGCAGG - Intergenic
1131198147 15:90373485-90373507 GAGGAGCACAGAGTGGTTGTGGG + Intergenic
1131275614 15:90978270-90978292 AAGGAGAGAAGAATGGATGTTGG - Intronic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1132422127 15:101679226-101679248 AAGGAGAGGAGACTGAAGGTGGG - Intronic
1134533268 16:15002097-15002119 AAGGACTGAAGAGTGAGTGTCGG + Intronic
1134859182 16:17545798-17545820 AAGGAAAGCAGATTAGTTGTCGG - Intergenic
1135423243 16:22318440-22318462 GAGCAGAGCACAGTGATTGAGGG + Intronic
1136633671 16:31505305-31505327 CAGGAGAACAGGGTGATAGTGGG - Intronic
1136998137 16:35205334-35205356 CAGGAGAACAGGGTGATGGTGGG - Intergenic
1138748312 16:59389413-59389435 AAGGAGGGCACAGTGCATGTGGG - Intergenic
1139439094 16:66955594-66955616 CAGAAGAGCAGGGTGATAGTGGG + Intergenic
1140188813 16:72797078-72797100 AAGGAGGGCAGAGTGACTCTGGG + Exonic
1140875550 16:79149497-79149519 AAGGAAAGCATACTGTTTGTTGG + Intronic
1141265564 16:82493869-82493891 AAGGAGAGAAGAGGGGTTGGAGG - Intergenic
1141416483 16:83879403-83879425 CAGGAGAACAGGGTGATAGTGGG + Intergenic
1141422013 16:83923737-83923759 AAGGAGAGCTGGGTGGTGGTCGG - Exonic
1142794272 17:2295250-2295272 AGGGAGAGCAGCGTGATTTATGG - Intronic
1143306662 17:5952814-5952836 GAGGAGAGCAGAGAGAGAGTTGG + Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1143418444 17:6768965-6768987 AAGGAGAGTTGAGAGAATGTGGG - Intronic
1143942383 17:10556141-10556163 CAGGATAGCAGAGGGTTTGTGGG - Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146242678 17:31244616-31244638 ACGGACAGCACAGTGATTATGGG - Intronic
1147149913 17:38508761-38508783 AAGGTGAGCAGTGTGAATGGAGG + Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1150092479 17:62340069-62340091 AAGGAGAGCAGATTCATGCTGGG + Intergenic
1150202077 17:63368062-63368084 ATAGAGAGCAGAGTGTATGTGGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151573852 17:74941455-74941477 AAGGAGAACCGAGTGGATGTGGG + Exonic
1152039115 17:77891861-77891883 ACGGAGAGAAGAGTGATTAATGG - Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1154530870 18:15343966-15343988 TAGGAGAGCAGGGTGATAATAGG + Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1156159689 18:34344582-34344604 AAGGTGAACAGAGTGACTGTGGG - Intergenic
1156384354 18:36592489-36592511 AAGGAGATCAGAGGGCTTGGCGG + Intronic
1156437984 18:37154164-37154186 AAGGAGAGGAGAGTGAGAGAGGG + Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159091389 18:63853094-63853116 CAGGAGAACAGGGTGATAGTGGG - Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159513600 18:69428732-69428754 AAGGAGAATAGAGAGGTTGTTGG - Intronic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1159986516 18:74848298-74848320 AAGGTCAGCAGAGTCATTTTTGG + Intronic
1161466238 19:4432196-4432218 GAGACGAGCAGAGTGAGTGTGGG + Exonic
1162278525 19:9677013-9677035 CAGGAGAACAGGGTGATAGTGGG + Intergenic
1163628239 19:18403223-18403245 CAAGAGAGCAGGGTGATAGTGGG - Intergenic
1165111527 19:33505239-33505261 GTGGAGAGCAGAGTGAGAGTCGG - Intronic
1165645267 19:37430885-37430907 AGGGAGACCAGAGTGATTGCAGG + Intronic
1166144232 19:40823370-40823392 CAGGAGAACAGGGTGATAGTGGG - Intronic
1166715699 19:44965967-44965989 AAGAAGAGGAGAGTGGTTATGGG + Intronic
1168292689 19:55364491-55364513 AAGGAGAGAGGTGGGATTGTGGG - Exonic
1168484243 19:56747545-56747567 TAGGAGAGCTGAGTGATTCGTGG - Intergenic
1168616603 19:57842666-57842688 AAGGAGAGCAGACTTCTTTTGGG - Intronic
925115313 2:1373744-1373766 AGGGAGAGCGGAGAGACTGTGGG - Intergenic
925119992 2:1410903-1410925 ATGGAGAGCAGAGAGATTGCAGG - Intronic
925142642 2:1560483-1560505 CAGGAGAACAGGGTGATAGTTGG + Intergenic
925484838 2:4316526-4316548 AAGGACAGTACAGTAATTGTGGG - Intergenic
926357306 2:12052912-12052934 AGGGAGAGGAGAGTGACTCTTGG + Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
928455326 2:31415776-31415798 AAGAAGACCAGAGTGAATGCTGG - Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928574055 2:32636919-32636941 GAGGACAGCATAGTGTTTGTGGG + Intronic
928726328 2:34178034-34178056 AAGGAGACCACAGCTATTGTGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
928982085 2:37146481-37146503 AAAGAGATGAAAGTGATTGTAGG - Intronic
929041766 2:37751347-37751369 CAGGAGAACAGGGTGATAGTTGG - Intergenic
930207368 2:48601683-48601705 AAAGAGATCAGAGAGATTGTGGG + Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
932101144 2:68900382-68900404 AAGGACAGCAAGGTGATTGTAGG + Intergenic
933593313 2:84257414-84257436 AAGGATGTCAGAGTGATTGAAGG - Intergenic
933615953 2:84482786-84482808 AAGGAGCACAGATTGAGTGTAGG + Intergenic
934123822 2:88866717-88866739 CAGGAGAACAGGGTGATAGTAGG + Intergenic
935132413 2:100270577-100270599 CAGGAGAGCAGGGTGATAGTGGG - Intergenic
936577342 2:113667773-113667795 AAGGTGAGCAGAGAGAGGGTGGG + Intergenic
936864885 2:117066191-117066213 AAGGAGGGCAGAGTGTAGGTAGG - Intergenic
937678428 2:124617801-124617823 AAGGTGTGCATAGTGCTTGTTGG + Intronic
938529963 2:132175236-132175258 TAGGAGAGCAGGGTGATAATAGG + Intronic
939476629 2:142695316-142695338 CAGGAGAACAGGGTGATGGTGGG + Intergenic
940358290 2:152769295-152769317 CAGGAGAGCAGGGTGATAGTTGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940992676 2:160113958-160113980 AAGGCGAGCAGAGTGAGCCTGGG - Intronic
941109240 2:161400220-161400242 AAGCAGAGCAGAGAGATAGAAGG - Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
941748119 2:169108875-169108897 AAGGAGAAAAGAGGGATTCTTGG - Intergenic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943177104 2:184490663-184490685 AGGGAGAGCAGAGAGATTGGGGG + Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
944375918 2:199042048-199042070 ATGGAGGGGAGAGTGAATGTAGG - Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944928906 2:204495822-204495844 AAGGAAAAAAGAGTGATTGTGGG - Intergenic
945435951 2:209817715-209817737 AAGGACAGCAGGGAGAGTGTGGG - Intronic
946058053 2:216918516-216918538 AAGGAGAGGAGGGTGCTTGGAGG - Intergenic
946073932 2:217058034-217058056 AAGGAGAAAAGAGTGAATGATGG - Intergenic
946204776 2:218096287-218096309 TAGGAGAGCAGGGTGATAGTGGG - Intergenic
946253942 2:218429976-218429998 GAGGAGGGCAGAGTGATGGGAGG + Intronic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947342931 2:229159022-229159044 CAGCACAGCAGGGTGATTGTAGG + Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948720716 2:239898417-239898439 AAAAAGAGCAGAGTGTGTGTAGG - Intronic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1169392544 20:5202340-5202362 AAGGAGGGAAGAGGGATTGCTGG + Intergenic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170397810 20:15946883-15946905 CAGGAGAGCAGGGTGATAGTGGG + Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171324756 20:24281624-24281646 AAGGAGGGCAGAGGTATTCTAGG + Intergenic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172130212 20:32650323-32650345 CTGGGGAGCAGAATGATTGTGGG + Intergenic
1172955630 20:38756134-38756156 AAAGAGAGCAGAGGGGATGTGGG + Intronic
1173696385 20:45018316-45018338 AAGTAGAAAAGAGTCATTGTAGG + Intronic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1175057564 20:56212000-56212022 CAGGAGAACAGGGTGATAGTGGG + Intergenic
1175853605 20:62107069-62107091 AAGGAGACCAGAGTGGCTGGAGG - Intergenic
1176003749 20:62847986-62848008 AAGGAGAGCAGAGAAATGGGCGG + Intronic
1176766542 21:13024498-13024520 TAGGAGAGCAGGGTGATAATAGG - Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1177290435 21:19104087-19104109 CAGGAAAGCAGGGTGATGGTGGG - Intergenic
1177465829 21:21479266-21479288 AAAGATAGCAGAGTCATTGGGGG - Intronic
1179714085 21:43278899-43278921 CAGGAAAGCAGCGTGTTTGTGGG + Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1181433536 22:22897100-22897122 AATAAGAGCTGAGTGAATGTGGG + Intergenic
1183335395 22:37243418-37243440 AAGGATGGGAGGGTGATTGTGGG - Intronic
1184382837 22:44156836-44156858 ACAGAGAGCAGAATGATTGGTGG + Intronic
1185053776 22:48567479-48567501 AAGGAGAGCAGGGTGATCGTGGG + Intronic
1203293988 22_KI270736v1_random:22867-22889 CAGGAGAACAGGGTGATAGTTGG - Intergenic
949876071 3:8626802-8626824 AAGGAAAGCAGAGTGAGAGGTGG + Intronic
949978377 3:9481605-9481627 GAGGAGAGCATAGTCATTGAAGG + Intergenic
950931788 3:16797292-16797314 GAGGAGGGCAGAGTTATTGCAGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
951817906 3:26775539-26775561 AAAGAGAGAAGGGTGATCGTGGG - Intergenic
952615144 3:35262145-35262167 CAGGAGAGAAGAGTGAGTGAGGG - Intergenic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
953548184 3:43879877-43879899 AAGGAGAACAGAGAAATTCTGGG + Intergenic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
954622908 3:52005883-52005905 AAGTGGAGAAGAGTGAGTGTCGG + Intergenic
955112088 3:55959419-55959441 ATGGAGAGCAGAGAGATCCTGGG + Intronic
955509526 3:59665473-59665495 AAGTAGAGGAGAGAGATTGGAGG + Intergenic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
955703024 3:61701066-61701088 AAGGAGGGCAGGGAGATTGAGGG - Intronic
956531688 3:70226879-70226901 AAGGAGAGAAGAGGGACTGGTGG + Intergenic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
956691629 3:71883562-71883584 AAGGAGAGAAGAGTGAGAGAAGG + Intergenic
957093682 3:75757605-75757627 AAGGGCAGCAGAATGAATGTTGG - Intronic
957219061 3:77358905-77358927 AAGATGAGCACAGTCATTGTAGG + Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957864918 3:86010031-86010053 AAATAGAGCAGAGTTAATGTCGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
957976229 3:87448189-87448211 AGGAAGAGTAGAGTGATTTTGGG - Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958710838 3:97715205-97715227 AATGAGAGCTGAGAAATTGTGGG + Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959057321 3:101581099-101581121 AAACAGAGCAGAGTGAGGGTGGG - Intronic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959541721 3:107547743-107547765 AAGGAGAGCAGAGTGAGGTGGGG - Intronic
959791539 3:110367811-110367833 CAGGAGAACAGAGTGATAGTGGG - Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960052124 3:113249088-113249110 GAGGAGAGCAGGGTGATTGCAGG + Intronic
960298188 3:115968999-115969021 AAGGTGAGCTCAGTGATTGTAGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
960742196 3:120846620-120846642 AAGGGGAGCAGAGTTTTTCTTGG - Intergenic
961644302 3:128384441-128384463 GACCAGAGCAGAGTGAGTGTGGG + Intronic
962128680 3:132649553-132649575 CAGGACAGCAGGGTGATAGTGGG - Intronic
962638917 3:137362309-137362331 AAGCAGAGTAAAGTAATTGTGGG - Intergenic
962715303 3:138120503-138120525 AAGGGGAGCAGAGTGACAGAAGG + Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963145018 3:141984562-141984584 AAGTAGAACAGAGGGATTGTGGG + Intronic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964179222 3:153864281-153864303 AAGGAAAGCACAGTGATTTAGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964494919 3:157278405-157278427 AAAGAGAGCAGAGGGAATGTGGG + Intronic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965351436 3:167616443-167616465 AAGAAAGTCAGAGTGATTGTAGG - Intronic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
966771854 3:183511141-183511163 TAGGAGAGCAGGGTGATAGTGGG + Intronic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968218459 3:196914930-196914952 AGGAAGAGCAAAATGATTGTGGG + Intronic
970418132 4:15879313-15879335 TAGGAGAGCAGGGTGATAATAGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972303899 4:37813097-37813119 AAGGAGAGCAGAGAAAGTGGAGG - Intergenic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974420808 4:61670883-61670905 AAGGAGTTCAGGGTCATTGTAGG + Intronic
974621184 4:64356633-64356655 TAGGAGAGCAGGGTGATAATAGG - Intronic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975519649 4:75286815-75286837 TAGGAGAGCAGGGTGATAATAGG + Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
977632137 4:99254897-99254919 AAGGAGAGTAGAATGAGTGTGGG - Intergenic
978174313 4:105710367-105710389 AAGGAGCCGAGTGTGATTGTGGG - Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979186562 4:117802854-117802876 AAGGAGAGCAGTATGTTTCTTGG - Intergenic
979245741 4:118502087-118502109 AAGGAGAGCAGGGTCTCTGTTGG - Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979823727 4:125206345-125206367 AAGGAGTGATGAGAGATTGTGGG + Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
979977225 4:127211913-127211935 AAGGAGAGCAGAGAAAATGGTGG - Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981282297 4:142972224-142972246 AAGGAGGGCAGAGTGAAAGGAGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
981650244 4:147049205-147049227 CATGAGAGCAGAGGGCTTGTGGG + Intergenic
982117933 4:152113408-152113430 GAGGAGAGGAGAGTGATGGAGGG + Intergenic
982339723 4:154284589-154284611 AGGGTGAGCATGGTGATTGTGGG + Intronic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
983313222 4:166093282-166093304 TAGGAGAGCAGGGTGATAATAGG + Intronic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983544980 4:168953402-168953424 ATGCAGATCAGAGTGAATGTAGG - Intronic
983634268 4:169881960-169881982 TAGGAGGGCAGAGTGGTTTTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983665697 4:170179861-170179883 ACAGAGAGCAAAGTGAATGTTGG - Intergenic
983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG + Intergenic
984717917 4:182943348-182943370 AAGGAGGACAGTGTGAGTGTTGG - Intergenic
984802749 4:183729755-183729777 AAGGAGAGCAGGGTGAGTGGGGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
987646632 5:20680924-20680946 AAGGAAAGCAGAGAGAAGGTGGG - Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
988239183 5:28587237-28587259 AAGGAGGGCAGTGTGAATGATGG + Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
988412253 5:30901620-30901642 CAGGAAAGCAGAATGATTTTAGG - Intergenic
990202965 5:53398311-53398333 AGGAAGACCATAGTGATTGTGGG - Intergenic
991673914 5:69074409-69074431 AAGGACAGCAGAGGGATGGATGG + Intergenic
991700969 5:69316139-69316161 AAGGAGGGCAGAGTGACTCTGGG + Intronic
991948416 5:71924474-71924496 AAGGAGAGCAGAGTGAGATTTGG - Intergenic
991959096 5:72023759-72023781 AAGGAAAGCATATTGATTTTTGG + Intergenic
992459368 5:76945709-76945731 TAGGAAAGCAGGGTGATAGTGGG - Intergenic
992656001 5:78910124-78910146 CAGGAGAACAGGGTGATAGTGGG - Intronic
992779136 5:80112413-80112435 CAGGAGAACAGGGTGATAGTGGG - Intronic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993069777 5:83145814-83145836 AATGAAAGCAGATTGATTCTGGG - Intronic
993364630 5:87020394-87020416 AAGGAGACCAGAATGAGTATGGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994534111 5:101006409-101006431 CAGGAGAGCAGGGTGATAGTGGG + Intergenic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995750516 5:115449142-115449164 CAGAAGAGCAGGGTGATAGTGGG - Intergenic
996111890 5:119575379-119575401 AAGGGGAAAAGAGTGATTCTGGG + Intronic
996633327 5:125663436-125663458 AATGAGATCAGTGTGAGTGTTGG + Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
996906691 5:128608971-128608993 AAGAACAGCACAGTGACTGTGGG - Intronic
997870989 5:137505051-137505073 AAGGAGGGCAGAGTGACACTAGG - Intronic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1001325621 5:170721725-170721747 AAAGAGAGGAGAGTGATGCTAGG - Intronic
1001665727 5:173432262-173432284 AATGAGTGCAGAGTTTTTGTTGG - Intergenic
1001933889 5:175691274-175691296 AAGGAGAGCAGAGAGGAGGTGGG + Intergenic
1002201357 5:177530504-177530526 AGGGAGAGATGATTGATTGTGGG - Intronic
1003369201 6:5508518-5508540 AAGGGGAGCAGAGTGCTGGCAGG + Intronic
1005227037 6:23655198-23655220 AAGGATAGGAGAGTGCTTGGGGG - Intergenic
1005252556 6:23964155-23964177 AAGGAGGGCAGTGTGATTGCAGG - Intergenic
1005430210 6:25748702-25748724 TAGGAGAGCAGGGTGATAGTGGG + Intergenic
1005765101 6:29003860-29003882 AAGGAAAGCAGTGTGAGTGGAGG - Intronic
1005793155 6:29328261-29328283 AAGGGGATTAGAGTGATTATGGG - Intergenic
1006107483 6:31725121-31725143 AAGGAGGGGAGAGGGATTATGGG - Exonic
1008049528 6:46886037-46886059 AATGAGAGCAGAGTTCATGTAGG - Intronic
1008271380 6:49494501-49494523 AAGGAAAGAAGAGTGTTTTTAGG + Intergenic
1008775769 6:55035745-55035767 AGGGAGAGCAGAGGAATTTTTGG - Intergenic
1009373629 6:62939374-62939396 AAGGAGAGCACAGTGATGGCAGG - Intergenic
1009443985 6:63717630-63717652 ATGCAGAGCAGAGTCATTGAGGG + Intronic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1011811042 6:91132711-91132733 AAGCAGAGCAAAGTCTTTGTTGG + Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012632784 6:101494331-101494353 AATCAGTCCAGAGTGATTGTAGG + Intronic
1012875545 6:104721355-104721377 GAGGAGAGGGGAGTGATGGTGGG + Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013265006 6:108487807-108487829 AATGAGAGCAGAGTGCATGTTGG + Intronic
1014698301 6:124651741-124651763 TAGGAGGGCAGAATGATTTTGGG - Intronic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015394734 6:132721023-132721045 CAGGAGAACAGGGTGATAGTGGG + Intergenic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015890770 6:137967812-137967834 TGGGACAGCAGAGTGATGGTGGG - Intergenic
1015890787 6:137967882-137967904 TGGGACAGCAGAGTGATGGTGGG - Intergenic
1015890810 6:137967983-137968005 TGGGACAGCAGAGTGATCGTGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016185774 6:141196251-141196273 GAGGAGAGCAGAGGGATTAGTGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016354084 6:143198892-143198914 AAGGAGAAAAGAGAGATTGTGGG + Intronic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017281036 6:152626197-152626219 ATGAAGAGTAGAGTGTTTGTAGG + Intronic
1017369645 6:153690084-153690106 AAGGAAAGCAGTGTTATTGGAGG + Intergenic
1017497389 6:154994439-154994461 AAGGCGAGGAGAGTGATTCCAGG + Intronic
1019797311 7:3060365-3060387 ATAAAGAGAAGAGTGATTGTTGG - Intergenic
1019844638 7:3485433-3485455 AGGGAAAGCAAAGTGAGTGTGGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021098655 7:16562670-16562692 CAGGGGAGCAGAGGGATTCTGGG + Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1022516170 7:30976275-30976297 AAAAAGCCCAGAGTGATTGTGGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1023917015 7:44597113-44597135 AAGGAGAGGAGAGTGAGGGAAGG + Intergenic
1024252182 7:47514529-47514551 AAGGAGACCAGAGGGAAAGTGGG - Intronic
1024700099 7:51897599-51897621 AGAGAGAGCAAAGTAATTGTCGG - Intergenic
1024824941 7:53380377-53380399 AAGGACAGCAGAGTGTGTTTTGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1026855344 7:73749907-73749929 CAGGAGAACAGGGTGATAGTGGG + Intergenic
1027306765 7:76906552-76906574 AAGCAGAGGAGAGTGATTCCAGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028284715 7:88981787-88981809 GAGGAGAGCACAGTGATCTTGGG - Intronic
1028568623 7:92260985-92261007 AAGGAAAGCAGAGTAAATGTTGG - Intronic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1029790610 7:102839267-102839289 TAGGAGAGCAGGGTGATGGTGGG - Intronic
1030431723 7:109456350-109456372 AAGAACAGCACAGTGATTATCGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032180498 7:129672662-129672684 AAGGAGTGCTGGGTGATTTTTGG + Intronic
1032190373 7:129762044-129762066 AAAGGGAGCAGAGTGATTTGGGG - Intergenic
1032741384 7:134742858-134742880 TAGGACTGCAGAGAGATTGTGGG + Intergenic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033828185 7:145218359-145218381 GAGGAGAGCAGAGGGGCTGTAGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1035333398 7:158111010-158111032 CAGGAGAGCAGGGTGTGTGTGGG - Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1035517275 8:246127-246149 AAGGACAGAAGAGTGATTGAAGG - Exonic
1035613707 8:987127-987149 AAGGAGAGCAGAGAGAATTCAGG - Intergenic
1036023263 8:4872455-4872477 AAGGAGTGCTGAGTGATGGGAGG - Intronic
1036493121 8:9246081-9246103 TAGGAGATCAGAGTGACTATGGG - Intergenic
1036778477 8:11629619-11629641 AATGAGGGCAGAGGGAGTGTGGG + Intergenic
1037156339 8:15704077-15704099 AAGTAAAGCAGAGTGATAGAAGG + Intronic
1037246824 8:16844979-16845001 AAGGAAATCAGAGGGGTTGTGGG - Intergenic
1037856437 8:22374524-22374546 AAGGAGAGCCGTGTGAATGCTGG + Intronic
1038730037 8:30118741-30118763 CAGGAGAGCAGGGTGATAGTGGG + Intronic
1039473996 8:37829803-37829825 GAGCAGAGCAGAGGGAGTGTGGG - Intronic
1039683505 8:39769401-39769423 CAGGAGAGGAGTGTGACTGTGGG - Exonic
1040290280 8:46120655-46120677 AATGAGACCACAGCGATTGTTGG - Intergenic
1040343188 8:46455726-46455748 TAGGAGAGCAGGGTGATAATAGG + Intergenic
1040745520 8:50636566-50636588 AAGGAGAGCATAGTGACTTTGGG - Intronic
1040962707 8:53051862-53051884 TAGGAGAGCATGGTGAGTGTTGG + Intergenic
1041562884 8:59240580-59240602 AAGGTGAGCAGGGTGAGAGTAGG - Intergenic
1041971457 8:63747536-63747558 AAGAAAACCAGAGTGATTCTGGG - Intergenic
1042993546 8:74667686-74667708 CAGGAGAGCAGATTGTCTGTTGG - Intronic
1043144398 8:76634230-76634252 AATGAGAGCAGAGTGAAGGTGGG - Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043567203 8:81561639-81561661 AAGGAGGGCACGGTGATTGTGGG + Intergenic
1043585233 8:81760899-81760921 AAAGAGAGCAAAGTGGTGGTGGG + Intergenic
1043749587 8:83918843-83918865 TAGGAGAGAAGAGGGATGGTAGG + Intergenic
1043828954 8:84964717-84964739 CAGAAGAGCAGAATGATTCTAGG + Intergenic
1044240790 8:89886499-89886521 AAGTAGAGCAGAGTGAGCTTGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045070073 8:98493844-98493866 AAGGAGAGAAGAGGGGTTGGTGG - Intronic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1045952100 8:107864169-107864191 AAGGAGTGCAGAGTGAAGGTTGG + Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047969779 8:130074751-130074773 AAGGAGAGGAGAGACAGTGTAGG + Intronic
1048027333 8:130598673-130598695 GAGGAGAACAGAGAGATGGTTGG - Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048449910 8:134524126-134524148 AAGGAGAGCAGGGGGATGGTTGG - Intronic
1048902144 8:139049103-139049125 CAGGAGAACAGGGTGATAGTGGG + Intergenic
1049501342 8:142968904-142968926 CAAGAGAACAGAGTGATGGTGGG + Intergenic
1049506315 8:143001522-143001544 TAGGAGAGCAGGGTGATAATAGG - Intergenic
1049790010 8:144468170-144468192 CAGGAGAGCAGAGGGACTGTGGG + Intronic
1049867775 8:144950214-144950236 TAGGAGAGCAGGGTGATAATAGG - Intronic
1050385183 9:5082250-5082272 CAGGAGAGCAGGGTGATAGTGGG + Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051679221 9:19590454-19590476 ATGGAGAGCAGGGTGTTTGGAGG - Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052138181 9:24941973-24941995 AAGAAGAGCAGACTGGTTCTGGG + Intergenic
1052819903 9:33130208-33130230 AAGGAATGCAGAATGTTTGTGGG - Intronic
1053118061 9:35522954-35522976 AAGGTCAGCAGAGTGATTATTGG + Intronic
1053708573 9:40781710-40781732 TAGGAGAGCAGGGTGATAATAGG + Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054418484 9:64902505-64902527 TAGGAGAGCAGGGTGATAATAGG + Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056211299 9:84367664-84367686 CAGGAGAACAGAGTGATGATGGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1057026398 9:91737017-91737039 AAGTCAAGCAGAGTGAGTGTGGG + Intronic
1057431927 9:95002960-95002982 TAGAAGAGCAGAGTGACAGTAGG + Intronic
1057528882 9:95826748-95826770 AAGGAGAGCAAAGAAATTGGAGG - Intergenic
1057891050 9:98870095-98870117 AAGTAGAGGAGAGTGGATGTTGG + Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1060309683 9:122448146-122448168 CAGGAGAACAGGGTGATAGTGGG + Intergenic
1062509004 9:136894568-136894590 GAGGAGAGCAGGGGGATTGGGGG + Intronic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186602260 X:11050303-11050325 AAGGAGAACATAGTGATCATGGG - Intergenic
1187362889 X:18644548-18644570 AAGGAGATCAAAGTGATTTCAGG - Exonic
1187403172 X:18980612-18980634 CAGGAGAACAGGGTGATAGTGGG - Intronic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188421225 X:29992518-29992540 AGGGAGGGCATAGTAATTGTGGG - Intergenic
1188585816 X:31773882-31773904 TAGGAGAGTAAAGTGATTGGTGG + Intronic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1188974775 X:36659978-36660000 AAGGAGAGCACAGAGACTGGGGG + Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189640650 X:43067449-43067471 AAGGAAAGTGTAGTGATTGTGGG + Intergenic
1189845882 X:45138071-45138093 AAGGAGAGATGAGAGATTGCTGG - Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190498451 X:51051566-51051588 AAAGAGAGTAAAGTGATTATGGG + Intergenic
1190521508 X:51282852-51282874 AAAGAGAGTAGAGAGATTGTGGG + Intergenic
1191018446 X:55835430-55835452 CAGGAGAACAGGGTGATAGTAGG + Intergenic
1191055251 X:56233548-56233570 AAGGAGAGGAGAGAGCTTGGTGG + Intronic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG + Intergenic
1192690085 X:73353692-73353714 AGTGAGACCAGAGTGCTTGTTGG + Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193738353 X:85186634-85186656 AAAGAGACCACAGTGACTGTGGG - Intergenic
1193750513 X:85337271-85337293 AGGGAGAGCAAGGTGAGTGTGGG - Intronic
1193842922 X:86430756-86430778 AAGGAGAGAAGAATGCTTTTTGG - Intronic
1193848965 X:86511960-86511982 AAAGAGACCAGAGTAATTGAAGG + Intronic
1193931694 X:87561371-87561393 GGGGAAAGCAAAGTGATTGTAGG + Intronic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195543435 X:106088249-106088271 AAGGAAAGCACAGCAATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195691148 X:107626619-107626641 AATGAGATAAGAGTGATTGGAGG - Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196393711 X:115236632-115236654 AAGGAGAACAGAGGGAAAGTAGG + Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197887222 X:131231126-131231148 TGGGAGAGCGGAGTGATTGGAGG + Intergenic
1198292961 X:135256746-135256768 AAGGAGAGGAGAGTGAATAAAGG + Intronic
1198697362 X:139355765-139355787 GAGAAAAGCACAGTGATTGTGGG - Intergenic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1199216086 X:145261979-145262001 AAGGAAAGAAGAGGTATTGTTGG + Intergenic
1199256962 X:145728282-145728304 AAGGAAAGCAGTGTGATTTGGGG - Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199772209 X:150982497-150982519 CAGGAGAGCAGAGGGAATGAGGG + Intronic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic