ID: 1077913598

View in Genome Browser
Species Human (GRCh38)
Location 11:6595984-6596006
Sequence CAAGGTTACCTTGAAGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077913594_1077913598 1 Left 1077913594 11:6595960-6595982 CCATCACCGTCAAAACATGTGCT 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1077913598 11:6595984-6596006 CAAGGTTACCTTGAAGAGGAAGG 0: 1
1: 0
2: 0
3: 29
4: 183
1077913595_1077913598 -5 Left 1077913595 11:6595966-6595988 CCGTCAAAACATGTGCTTCAAGG 0: 1
1: 0
2: 1
3: 15
4: 195
Right 1077913598 11:6595984-6596006 CAAGGTTACCTTGAAGAGGAAGG 0: 1
1: 0
2: 0
3: 29
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077913598 Original CRISPR CAAGGTTACCTTGAAGAGGA AGG Exonic
901055023 1:6445380-6445402 CAGGGTCACCTGGAAGGGGAGGG - Intronic
901096414 1:6683829-6683851 CAAGGTTCTCTAGAAGAGGTGGG + Intronic
901230088 1:7636983-7637005 GAAGGCTTCCTGGAAGAGGAGGG + Intronic
901617645 1:10554467-10554489 CCAGGTCACCTTGAAGAGGCAGG + Intronic
902167406 1:14583712-14583734 GCAGGTGACCCTGAAGAGGATGG + Intergenic
902479341 1:16703234-16703256 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
904999143 1:34654534-34654556 CAAGGTTTCCTTAGAGAGGCTGG + Intergenic
905317575 1:37093341-37093363 CAAGGTATCCTTGAACTGGAAGG + Intergenic
907621472 1:55985431-55985453 CCATATTACCTGGAAGAGGATGG - Intergenic
907712584 1:56898060-56898082 GAAGTTTACCTGGAAGAGAAGGG + Intronic
909050124 1:70756356-70756378 CAAGATTACAATTAAGAGGAGGG - Intergenic
910102991 1:83598506-83598528 CAAGGATAGCCTCAAGAGGATGG - Intergenic
910260597 1:85290025-85290047 CAAGGTTATCATCAAGAAGATGG - Intergenic
910476421 1:87612334-87612356 CAAGGCAACCTTGAAAAGCATGG + Intergenic
915976869 1:160397079-160397101 CAAGGTTTCATAGATGAGGAAGG + Intergenic
917010013 1:170460501-170460523 CAAGGTTACTCTGAAGTGGAGGG - Intergenic
919584762 1:199422620-199422642 CACTGTTTCCTTGAAGAGAAGGG + Intergenic
921784307 1:219209818-219209840 CAAAGTTCCCCTGAACAGGAGGG + Intronic
922393563 1:225172712-225172734 CACTGGTAGCTTGAAGAGGATGG - Intronic
922772574 1:228194900-228194922 CATGGTGACCTTCAAGAAGATGG - Intergenic
924593272 1:245423273-245423295 CAGGGTTACTGTGAAGATGAAGG - Intronic
924624465 1:245687702-245687724 CAAGGCTACCCTGGAGGGGAAGG + Exonic
1063803428 10:9609017-9609039 CAAGAGTACCTTGGAGAGGATGG + Intergenic
1064708964 10:18103489-18103511 CAAGAAAACCTTGAAGAGGAGGG + Intergenic
1065300667 10:24318392-24318414 TGAGGTTTCCTTGAGGAGGAGGG + Intronic
1066054749 10:31670358-31670380 CAAGGATAGCATTAAGAGGATGG + Intergenic
1066109945 10:32186997-32187019 CAAGGTTTACTGGGAGAGGATGG - Intergenic
1066630265 10:37452797-37452819 AAAGGTCACCTTGAAGAAGATGG - Intergenic
1069213263 10:65788208-65788230 AAATGTTTCCTTGAAGAGGTAGG - Intergenic
1070662148 10:78314667-78314689 CAAGGTAACAGTGAAGAGCAGGG - Intergenic
1071987354 10:91065608-91065630 CTAGCTTACCTTAAAGAGCATGG + Intergenic
1073167233 10:101466579-101466601 CAAAGTATCCTTGAAGAGGATGG - Intronic
1073192173 10:101659267-101659289 CAAGGTTACCTGGCATAGAAGGG + Intronic
1074055685 10:109921680-109921702 CAAGGTTCCCATCAAAAGGAGGG - Intronic
1075012769 10:118888814-118888836 TAAAGTTACCTAGAAGAGGATGG - Intergenic
1076980177 11:199930-199952 CAGGGTCACCTGGGAGAGGAGGG - Exonic
1077913598 11:6595984-6596006 CAAGGTTACCTTGAAGAGGAAGG + Exonic
1079984972 11:27190599-27190621 GAAGGATACTTTGAAAAGGAGGG - Intergenic
1080566478 11:33514054-33514076 CAAGGTTACCTCAGAGAGAAAGG + Intergenic
1082311016 11:50648598-50648620 CATTGTTAGCTTGAAGGGGATGG + Intergenic
1084039827 11:66535806-66535828 CAAGGTTACATGGAAGAGCAAGG + Intronic
1088583517 11:111337092-111337114 CAAGGTTCACTGGAAGGGGAAGG + Intergenic
1089022459 11:115230495-115230517 CAGGGTAACTTTGAAAAGGAAGG + Intronic
1091638250 12:2214616-2214638 CAAGGTGAGCCTGAAGGGGATGG + Intronic
1099720318 12:86353937-86353959 CAAGGTAATCAAGAAGAGGATGG + Intronic
1100167632 12:91935523-91935545 CAAGGTTAACAGGAAGAGGTAGG + Intergenic
1101733265 12:107443949-107443971 CAGGGTCACCTAGATGAGGATGG + Intronic
1102214061 12:111147709-111147731 CAAGGTCACCTGGCAGAGGAGGG + Intronic
1102821509 12:115912907-115912929 GAAGTTTCCCTTAAAGAGGAAGG + Intergenic
1103883314 12:124183014-124183036 CTAGATTAACTTGAAGAGGTAGG - Intronic
1107384805 13:39896400-39896422 GAAGGTTAGCTTGGGGAGGAAGG + Intergenic
1107747777 13:43530089-43530111 GAAGGTTACCTTGGAGAGAAGGG + Intronic
1109864542 13:68245655-68245677 CAAGTATCCATTGAAGAGGAGGG + Intergenic
1113006468 13:105708171-105708193 GAAGATTACAATGAAGAGGAGGG + Intergenic
1113196760 13:107817550-107817572 CAAGGATTTCTTTAAGAGGAGGG - Intronic
1113242222 13:108350602-108350624 CCAGATTACCATAAAGAGGATGG - Intergenic
1116001891 14:39252293-39252315 CAAGGCTACTTATAAGAGGAAGG + Intronic
1116791892 14:49348124-49348146 GAGGGTGACCTTGGAGAGGAAGG - Intergenic
1119886612 14:78148933-78148955 CATGGCTATTTTGAAGAGGAAGG + Intergenic
1120389957 14:83893838-83893860 CAGGGTGACCTTGAAGAGAATGG - Intergenic
1120866871 14:89302658-89302680 CCAGGTAGCATTGAAGAGGAAGG - Intronic
1124036870 15:26061665-26061687 CAAGGTTAGCATCAAGGGGAGGG + Intergenic
1126677507 15:51173241-51173263 CAAGGCTACCTTCAAGGGGCTGG + Intergenic
1127658184 15:61075335-61075357 CAAGGTGACCTTGGAGAGCAGGG - Intronic
1129281438 15:74488254-74488276 CAAGGCTGCCTTGAAGATGTAGG + Intergenic
1133363699 16:5194357-5194379 TCTGGTGACCTTGAAGAGGAGGG - Intergenic
1133691678 16:8221665-8221687 CAAGTTTACTGTGGAGAGGATGG - Intergenic
1137622127 16:49883060-49883082 CAAGGTTACCTCTATGAGGATGG + Intergenic
1139363150 16:66415959-66415981 CATGGATGCCTTGCAGAGGAGGG - Intergenic
1139576475 16:67845572-67845594 CAAGGATACACTGAAGAGCATGG - Intronic
1142107772 16:88315551-88315573 CCAGGTGACTTTGCAGAGGAGGG + Intergenic
1144890798 17:18492926-18492948 CTGGGGTACCTTGAACAGGATGG + Intronic
1145056414 17:19706630-19706652 CATGGGTACGTGGAAGAGGATGG - Exonic
1150907519 17:69354078-69354100 TAAGGTAACCTTGATGAGCAGGG - Intergenic
1151162970 17:72181386-72181408 CAAGGTAAACGGGAAGAGGATGG - Intergenic
1152625382 17:81385818-81385840 CAAGATTACGTTGAACAGGCTGG - Intergenic
1159700848 18:71624618-71624640 CCAGGTTACTTTGAAAAGCAAGG + Intergenic
1162066039 19:8126091-8126113 CAAGTTGTCCTTGAGGAGGAAGG + Intronic
1162238223 19:9324709-9324731 GAAGGTCACCGTGAACAGGAAGG - Exonic
1164535457 19:29083579-29083601 AATGGTTACCTGGAAGGGGAGGG + Intergenic
1164761730 19:30733261-30733283 CATGATTACCTTGAAGATGCAGG - Intergenic
1202713380 1_KI270714v1_random:29140-29162 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
926223383 2:10950929-10950951 AAGGGTTTCCTGGAAGAGGATGG - Intergenic
927071206 2:19531304-19531326 CAAGGAGGCCTTGAAAAGGAAGG - Intergenic
927484577 2:23479705-23479727 CAAGGCTTCCTTGGAGAGCAAGG - Intronic
927981127 2:27375832-27375854 CAATGGTACCTGGGAGAGGAAGG - Exonic
928898706 2:36294511-36294533 AGAGGTTAACTTGAAGTGGAAGG - Intergenic
930046498 2:47176980-47177002 GAAGGATACGTGGAAGAGGAAGG - Intergenic
931071178 2:58652184-58652206 CAAGGATGCATTGAAGAGAAAGG + Intergenic
934990065 2:98914553-98914575 AAAGTCTCCCTTGAAGAGGATGG - Intronic
935099855 2:99983187-99983209 AAAGTTTTCCTTGAAGAGGATGG + Intronic
935394984 2:102597926-102597948 CCAGGTTTCCTTGAACTGGATGG - Intergenic
937152848 2:119697744-119697766 CGAGGTTGCTGTGAAGAGGAGGG - Intergenic
937157308 2:119730200-119730222 GAGGGTTTCCTTGAAGAGGGTGG - Intergenic
937528204 2:122796576-122796598 GAAGTTTACCTTGAAGGAGAGGG - Intergenic
941032914 2:160533338-160533360 AAAGGTGACCTTGATGAGGAAGG + Intergenic
941700471 2:168599161-168599183 TCAGGTTACCTTGCAGAGCATGG + Intronic
941746854 2:169095940-169095962 CAAGTTTTCTTTGAAAAGGAGGG + Exonic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945058019 2:205884973-205884995 CAAGGTGACCCAGATGAGGAGGG - Intergenic
945670227 2:212793566-212793588 CAAGGTTACCTTCACCAAGAAGG - Intergenic
947377921 2:229515936-229515958 CAAAGCTAACTTGAAGAGGCTGG - Intronic
949056849 2:241932489-241932511 CAAGGTTTCCAGGAAGGGGAAGG - Intergenic
1169838269 20:9905187-9905209 AAAGGTTACCTTGGGGATGAAGG + Intergenic
1170472880 20:16685756-16685778 CATGGTTACCCTTGAGAGGAAGG + Intergenic
1174364110 20:50046088-50046110 GAAGGTTACATTGGAGAGGCTGG - Intergenic
1174540545 20:51285882-51285904 CAAGATTGCTTTGAGGAGGAAGG - Intergenic
1174846443 20:53947934-53947956 CAGGGTTAGCATGAAGATGAAGG - Intronic
1174966219 20:55219029-55219051 TAAGTTTAGCTTGCAGAGGAAGG + Intergenic
1175213174 20:57374624-57374646 CAAGGGTGCCATGAACAGGATGG - Exonic
1176888847 21:14289715-14289737 CAAGGTTTCCTTGAAAAAGGTGG - Intergenic
1178272679 21:31206986-31207008 AAAGGTTACTTTGAAGGGGAGGG - Intronic
1180078602 21:45475798-45475820 CAAGGTTGCCTCGAAGACCAAGG - Intronic
1182710009 22:32315860-32315882 CAAGGTTTCATAGAAAAGGATGG + Intergenic
1183117955 22:35706388-35706410 CAAAGTCTCCTTGAAGAGGCTGG - Intergenic
1183163966 22:36133547-36133569 CAAGGCTGGCTTGAAGACGAAGG - Intergenic
1183317723 22:37146088-37146110 AAAGGTCACCTGGAATAGGAAGG - Intronic
1183676650 22:39302573-39302595 CAGGGTTAACCTGAACAGGAAGG - Intergenic
1184397567 22:44252686-44252708 CAAGGTTTCATAGAAAAGGATGG + Intronic
950899170 3:16481776-16481798 CAATGTTACCTAGAGGAGCAAGG + Intronic
951447472 3:22799196-22799218 CAAGATAACCTAGAAAAGGATGG - Intergenic
953293119 3:41686340-41686362 CAGGGTTTCTTGGAAGAGGAAGG + Intronic
953704161 3:45218854-45218876 CAAGGTTATTTTGAGGAGGGTGG - Intergenic
954730266 3:52654601-52654623 CAAGGTCACCTTGAAGGAGCTGG - Intronic
956298347 3:67739096-67739118 CAATATTACTTTGTAGAGGAAGG + Intergenic
956635275 3:71357750-71357772 CCATGTGACCTTGAAGATGAAGG + Intronic
958126645 3:89365151-89365173 AAAGGTTTTCTTGAAGAGGTGGG + Intronic
958736691 3:98017478-98017500 CAAGGTTAGAATGAAGAGGATGG + Intronic
960377486 3:116921444-116921466 CAAGGTTACCAAGAAGCAGATGG + Intronic
960714958 3:120565772-120565794 CATGGTTGCCTTGTAGGGGAAGG - Intergenic
960915436 3:122689773-122689795 GAAGGTTTCCATGAAAAGGATGG - Intronic
961936589 3:130591065-130591087 GAAGGCTACCTGGGAGAGGAGGG + Exonic
962058526 3:131900442-131900464 CTAGGTTACCTTTATGTGGAGGG - Intronic
962061298 3:131930361-131930383 CAGGGTGACCTTGCAGAGAAAGG + Intronic
964194498 3:154046914-154046936 CAAGGGTAACTTGAAAAAGAAGG + Intergenic
966805652 3:183805467-183805489 CCAGGTTTCCTTGGACAGGAGGG - Intronic
967794104 3:193579702-193579724 CAAGGTCACTTTGGAGAGCACGG - Intronic
968163689 3:196447549-196447571 CAAGGTTACCTTGGTGATGGGGG - Intergenic
970723372 4:19014183-19014205 CAAGTTTACCTGGGGGAGGAAGG + Intergenic
972320106 4:37965515-37965537 CAGGGGTACCTTGAAGTGGAGGG + Intronic
974624937 4:64413468-64413490 CAAGGTTTCCTTTAATAGGAAGG - Intergenic
975124365 4:70765372-70765394 AATAGTTACCTTGAAGAGGTGGG + Intronic
976019141 4:80598733-80598755 CAATGTCACCTAGAGGAGGAAGG - Intronic
976602189 4:86948239-86948261 CAAGTTTACCATAAGGAGGAGGG - Intronic
979443465 4:120781253-120781275 CGATGCTACCTTTAAGAGGAAGG - Exonic
981383999 4:144106131-144106153 CAAGAATACCTATAAGAGGAAGG - Intergenic
981467573 4:145091915-145091937 CAAGGCTATCTTGAATAGGAGGG + Intronic
982296623 4:153835613-153835635 CAAAGTTACCTTCAAAAGGTAGG - Intergenic
984473214 4:180203648-180203670 CAAGATTATCTTGAAGACTATGG + Intergenic
988966331 5:36421890-36421912 CAAGGTACCCTAGTAGAGGAAGG - Intergenic
990212203 5:53492534-53492556 CAAGGTTCTGGTGAAGAGGATGG - Intergenic
994238076 5:97389043-97389065 CTAGCTTACATTCAAGAGGAGGG - Intergenic
995002121 5:107146009-107146031 CAAGCTTATCTTTTAGAGGAAGG - Intergenic
995382341 5:111549058-111549080 CAAGGTTTCCATGAAGAGTAAGG - Intergenic
997802012 5:136873165-136873187 GAAGGTTTCCTAGAAGAGGTGGG + Intergenic
998147894 5:139740636-139740658 CAAGGTTCCCCAGAAGAGGGAGG + Intergenic
1001834589 5:174820979-174821001 GAAGCTTACATTGCAGAGGAAGG - Intergenic
1002972475 6:2038015-2038037 CAAGGTTAACTTTAAAAGTATGG - Intronic
1003262746 6:4535978-4536000 AAAGCTTACATTGAAAAGGAAGG + Intergenic
1004064952 6:12234752-12234774 CAAGGTTACATTGATCAGGAAGG + Intergenic
1005133354 6:22537942-22537964 CAATGCTACCTTCATGAGGAGGG + Intergenic
1005272205 6:24178526-24178548 AATGGTGACCTTGAAGAGGAAGG - Exonic
1006397992 6:33799428-33799450 CAAGTTGACCTTGAAGAGCAAGG - Intronic
1007250996 6:40494906-40494928 CAAGAGTACTTGGAAGAGGATGG - Intronic
1007299753 6:40857932-40857954 CAAGGATAGCATGAAGAGGACGG - Intergenic
1009415181 6:63408128-63408150 CATGGGTAGCTTGATGAGGATGG - Intergenic
1011863134 6:91785929-91785951 GAAGTTTACCTTGAAGTGGGGGG + Intergenic
1013237340 6:108208845-108208867 CAAGGTTAACCAGGAGAGGATGG - Intergenic
1013396446 6:109745850-109745872 CAATGATAGCTTGATGAGGATGG - Intronic
1014881638 6:126730840-126730862 CACTGGTACCTTGATGAGGATGG - Intergenic
1015144730 6:129972863-129972885 CATGGTAGCCCTGAAGAGGATGG + Intergenic
1017700438 6:157064277-157064299 CAAAGTTACCTTAAAGAGCAAGG - Intronic
1018608014 6:165618745-165618767 CAAGGTTTCTTACAAGAGGAGGG - Intronic
1019046124 6:169147615-169147637 CAAGGTTAGCTTGGGAAGGATGG - Intergenic
1020457589 7:8391544-8391566 CAAGGGTCCTTTGAAGAGGGAGG + Intergenic
1020649955 7:10862095-10862117 CAAGGGTCCCCTGAAGAGGAAGG - Intergenic
1021100335 7:16581427-16581449 GAAAGGTACCTTGAAGAGGAAGG + Exonic
1021931648 7:25586796-25586818 GAAGCTTACATTGTAGAGGAGGG - Intergenic
1023296598 7:38721374-38721396 CAAGGCAACCTAGAAGAGAAGGG + Intergenic
1024380407 7:48689526-48689548 CATGGGTACCTTGATGGGGATGG - Intergenic
1024384069 7:48731391-48731413 CATGGGTACCTTGATGGGGATGG - Intergenic
1028079267 7:86553528-86553550 CATGGATAGCTTGATGAGGATGG - Intergenic
1031467202 7:122127084-122127106 GAAGGTTACCTGTAAAAGGAAGG - Intronic
1033424129 7:141227952-141227974 CAAGATTTCCTTGAAGTGTAGGG + Intronic
1035179498 7:157078655-157078677 CCAGGTGTCCTTGTAGAGGAGGG + Intergenic
1037348081 8:17921465-17921487 CACAGTTACCCTGAAGAGGCTGG - Intergenic
1037903575 8:22702571-22702593 CAAAGTTAACATAAAGAGGAGGG - Intergenic
1038859197 8:31367695-31367717 CAAGGTTACCTCTAAAAGCATGG + Intergenic
1040830051 8:51666214-51666236 CAAGGATAGCTTAAAAAGGAAGG - Intronic
1042060270 8:64809075-64809097 CAAGGTAAGCTTCAATAGGAAGG - Intergenic
1042606856 8:70554316-70554338 CAAGGATACCTTGAATAGTTGGG - Intergenic
1044218902 8:89646698-89646720 CAAGGTTCCTTTTAAGAAGAGGG + Intergenic
1044602967 8:94024311-94024333 CAAGGTTACCAGGATGAAGAAGG + Intergenic
1045720155 8:105099863-105099885 CAGGGAGACCTTGAAGAAGAGGG + Intronic
1046749221 8:117909581-117909603 CAAGGGTTCCTTGAGAAGGAGGG + Intronic
1047170559 8:122488593-122488615 CAATGGTACCTTGATGGGGATGG - Intergenic
1048961232 8:139580147-139580169 CAAGGTTACCACGAAGCTGAGGG + Intergenic
1049358522 8:142200640-142200662 CAAGGGTCCTTTTAAGAGGAAGG + Intergenic
1051338420 9:16088809-16088831 CAATGGTAGCTTGATGAGGATGG - Intergenic
1051623978 9:19080760-19080782 AAAGTTTACCTTAAAGAAGAGGG + Intronic
1055516738 9:77041579-77041601 GAAGCATACCTTGAAGATGAAGG - Intergenic
1058626478 9:106938902-106938924 CATGCTCACCTGGAAGAGGATGG - Exonic
1060064068 9:120487285-120487307 CAAGCTTACCTTAGAGAAGATGG + Exonic
1189383261 X:40516926-40516948 CAAGGATCCTTTTAAGAGGAAGG + Intergenic
1190064456 X:47230373-47230395 CTAGGAAACCATGAAGAGGAGGG + Intergenic
1192044801 X:67660756-67660778 CATGGGTAGCTTGATGAGGATGG + Intronic
1192073509 X:67965723-67965745 CATGGGTAGCTTGATGAGGATGG - Intergenic
1192222982 X:69210055-69210077 CAAGGCTTCCTGGAAGAGGCTGG + Intergenic
1194643127 X:96427137-96427159 CAATGGTACCTTGATGGGGATGG + Intergenic
1194804642 X:98312311-98312333 CAAGGATACCGTGAAGAAAATGG + Intergenic
1196371524 X:114984669-114984691 AAAGGTTTCCTTGAAGAGCATGG - Intergenic
1199764387 X:150930329-150930351 CAAGGGTCCTTTGAAGAGGTGGG - Intergenic
1201532906 Y:15011894-15011916 CATGGTTAGCTTGATGGGGATGG + Intergenic