ID: 1077914431

View in Genome Browser
Species Human (GRCh38)
Location 11:6602067-6602089
Sequence CTGGCAAATGATGCCTTTTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 194}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077914422_1077914431 28 Left 1077914422 11:6602016-6602038 CCCTGTTTTTGACATTTCTTCTT 0: 1
1: 0
2: 7
3: 81
4: 940
Right 1077914431 11:6602067-6602089 CTGGCAAATGATGCCTTTTTGGG 0: 1
1: 0
2: 0
3: 18
4: 194
1077914429_1077914431 -5 Left 1077914429 11:6602049-6602071 CCTACTTCAGCAGAGGCACTGGC 0: 1
1: 0
2: 1
3: 15
4: 174
Right 1077914431 11:6602067-6602089 CTGGCAAATGATGCCTTTTTGGG 0: 1
1: 0
2: 0
3: 18
4: 194
1077914424_1077914431 5 Left 1077914424 11:6602039-6602061 CCCTTTCTTCCCTACTTCAGCAG 0: 1
1: 0
2: 2
3: 45
4: 445
Right 1077914431 11:6602067-6602089 CTGGCAAATGATGCCTTTTTGGG 0: 1
1: 0
2: 0
3: 18
4: 194
1077914427_1077914431 -4 Left 1077914427 11:6602048-6602070 CCCTACTTCAGCAGAGGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 159
Right 1077914431 11:6602067-6602089 CTGGCAAATGATGCCTTTTTGGG 0: 1
1: 0
2: 0
3: 18
4: 194
1077914423_1077914431 27 Left 1077914423 11:6602017-6602039 CCTGTTTTTGACATTTCTTCTTC 0: 1
1: 0
2: 3
3: 53
4: 662
Right 1077914431 11:6602067-6602089 CTGGCAAATGATGCCTTTTTGGG 0: 1
1: 0
2: 0
3: 18
4: 194
1077914425_1077914431 4 Left 1077914425 11:6602040-6602062 CCTTTCTTCCCTACTTCAGCAGA 0: 1
1: 0
2: 1
3: 32
4: 328
Right 1077914431 11:6602067-6602089 CTGGCAAATGATGCCTTTTTGGG 0: 1
1: 0
2: 0
3: 18
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077914431 Original CRISPR CTGGCAAATGATGCCTTTTT GGG Exonic
900312230 1:2039266-2039288 CTGGCTAATGATACCTGTTGAGG - Intergenic
901260856 1:7869514-7869536 CTTGAAAATGCTGCCTTTCTAGG + Intergenic
905211538 1:36377798-36377820 CTGGCTCAGGATGCCTCTTTTGG + Intronic
905748024 1:40436201-40436223 TTTTGAAATGATGCCTTTTTTGG + Intergenic
906251923 1:44317305-44317327 CTGGCAGTTGGTGCCTTTTGCGG - Intronic
908246505 1:62231498-62231520 CTGGCAAATGAAGTCTATTTTGG + Intergenic
909027417 1:70498936-70498958 GTGGCAATAGATGCCATTTTAGG + Intergenic
909877211 1:80822724-80822746 TTGGCAAATGTTGCCATATTAGG + Intergenic
912048687 1:105494207-105494229 CTGGTGAATGCTTCCTTTTTTGG + Intergenic
912941638 1:114050133-114050155 CTGGCCAGTGATGTCTTTTTAGG + Intergenic
915978638 1:160406888-160406910 CTGGCTAATTTTGCATTTTTTGG + Intronic
919411879 1:197255594-197255616 CTGGCACATAATGCCTGTTTTGG + Intergenic
920697504 1:208192416-208192438 ATGGCAGATGATGACATTTTAGG - Intronic
921494810 1:215826372-215826394 TTGGCAAGTGATGCTTTCTTGGG - Intronic
922928132 1:229367673-229367695 CTGACAAATGAGGCTTTTGTAGG + Intergenic
923584612 1:235256620-235256642 CTGGCAAATGAAATCTTTTAAGG - Intronic
924345330 1:243068301-243068323 CTGGCTAATGTTTCTTTTTTTGG - Intergenic
1064067863 10:12198668-12198690 TTTTAAAATGATGCCTTTTTTGG + Intronic
1065000814 10:21336232-21336254 CTGGCTAATGATTACATTTTTGG + Intergenic
1065448195 10:25824481-25824503 CTGCAAAATGATGCCTGTTTCGG - Intergenic
1066731004 10:38436508-38436530 CTGGCTAATGTTTCTTTTTTTGG + Intergenic
1069930229 10:71876786-71876808 CTTGCAAATGATGCATTTGGTGG - Intergenic
1070335455 10:75450955-75450977 CTGGCATGTGATGCCGTTTCTGG + Intronic
1070652696 10:78249487-78249509 CTGTCAAAAGATTCCTTGTTCGG + Intergenic
1071274298 10:84038874-84038896 ATGGGAAATGATGGCTTATTTGG + Intergenic
1072127092 10:92456332-92456354 GTATCAAATGTTGCCTTTTTAGG - Intronic
1072367941 10:94733469-94733491 AGGGCACATGATACCTTTTTGGG + Intronic
1072860078 10:98994474-98994496 CTTGCCTATGATGCCTGTTTGGG - Intronic
1074632988 10:115279677-115279699 CTACCAAAAGATGCCTGTTTAGG + Intronic
1075286104 10:121187540-121187562 CTGGGAATTGATTCCTTCTTAGG - Intergenic
1077914431 11:6602067-6602089 CTGGCAAATGATGCCTTTTTGGG + Exonic
1078061642 11:8049939-8049961 CTGGCAAATGTTGTGTTTCTTGG - Intronic
1078974344 11:16454371-16454393 CTGGAAAGTTATGACTTTTTTGG - Intronic
1079018798 11:16892194-16892216 TTGTCAAATGATGCATTTTATGG - Intronic
1079944146 11:26720492-26720514 CAGGCAAATGAACACTTTTTAGG - Intronic
1080034398 11:27697610-27697632 TAGGCAAATGATGACTTTCTTGG + Intronic
1080848794 11:36049781-36049803 CATGCAAGTGATGCCTTTTCAGG - Intronic
1081388014 11:42495994-42496016 CTGGCCCATTATTCCTTTTTTGG - Intergenic
1082064861 11:47891800-47891822 CTGGCTAATGTTGTATTTTTAGG + Intergenic
1082109263 11:48256136-48256158 CCGGCAGCTGATGTCTTTTTAGG - Intergenic
1083366819 11:62146461-62146483 CTGTCACAAGATGCCTTTTCAGG + Intronic
1084634997 11:70385960-70385982 CTGGCAAAAGATGCAGTTGTGGG + Intergenic
1085444677 11:76592410-76592432 CTGGGAAATGCTGCATTTGTGGG + Intergenic
1086377535 11:86216166-86216188 CTTGCAAATGTTGCCTTATTTGG - Intergenic
1092047945 12:5445892-5445914 CAGGCAAATGCTGGATTTTTAGG - Intronic
1092096735 12:5849036-5849058 CCAGCAAGTCATGCCTTTTTAGG - Intronic
1092549218 12:9479453-9479475 CTGGCTAATTTTGCATTTTTTGG - Intergenic
1092680114 12:10969351-10969373 CACTCAAATGTTGCCTTTTTTGG - Intronic
1092838389 12:12514516-12514538 CTTGAAAATGGTTCCTTTTTTGG + Intronic
1093919466 12:24843821-24843843 CAGTCACATGATTCCTTTTTTGG + Intronic
1098690896 12:73486835-73486857 CCCTCAAATGATGCCTTTTCTGG - Intergenic
1099954552 12:89340603-89340625 CCAGAAAATGAGGCCTTTTTTGG + Intergenic
1100252518 12:92842723-92842745 CTGCCACATTATGCTTTTTTCGG + Intronic
1103812783 12:123629034-123629056 GTTGCAAACGAAGCCTTTTTTGG - Intronic
1104043202 12:125143922-125143944 CTGCAAAATGATGGCTTTTCTGG + Intergenic
1104476419 12:129074130-129074152 CTGCCCATTGATGCTTTTTTGGG + Exonic
1104709412 12:130974916-130974938 TTGGCAAATGGTGCCTTCTGGGG + Intronic
1105031983 12:132890417-132890439 GTGGCAAGTAATGCTTTTTTGGG + Intronic
1107279554 13:38718075-38718097 ATGTTAAATGATGTCTTTTTGGG - Intronic
1111469408 13:88658570-88658592 ATGGCAAATTTTGCCATTTTTGG - Intergenic
1111543920 13:89705281-89705303 CTGGGGAATGAAGCCATTTTTGG + Intergenic
1111843445 13:93478470-93478492 CTGGTAAATTATGCCTGTGTTGG - Intronic
1112667179 13:101588820-101588842 CTACCAAATGATTCCTTCTTTGG + Intronic
1114883887 14:26823226-26823248 CTGGCACATTATGCATTATTTGG + Intergenic
1118501961 14:66370347-66370369 CTGGAAAATGGTGCCATGTTGGG - Intergenic
1120128048 14:80770584-80770606 AAGGCAAATGATACATTTTTAGG - Intronic
1120275315 14:82366211-82366233 GTGGCAGATGATGCAGTTTTTGG - Intergenic
1120322840 14:82987752-82987774 CTGACAACTGATGGCTTTATAGG - Intergenic
1120825709 14:88953076-88953098 CTGGCCGATGAAGCCTTTGTTGG + Intergenic
1121430566 14:93884115-93884137 TTGGCAAATCATGGCTTTTGGGG - Intergenic
1121729198 14:96174557-96174579 CTGGTAACTGATGCCTTATGTGG - Intergenic
1122013036 14:98769470-98769492 CTGGCAGATGAAGCCTCTGTAGG - Intergenic
1122593871 14:102875043-102875065 CAGGCTAATGCTGCTTTTTTTGG + Intronic
1123101911 14:105809234-105809256 CTGGAAAATGAGGGCTTTATAGG + Intergenic
1124164912 15:27317800-27317822 CAGGAAAATGATGCCCTATTTGG - Intronic
1125260011 15:37812749-37812771 TTGGCTTATGATGCCTCTTTTGG - Intergenic
1127026494 15:54813115-54813137 CTGACCTAAGATGCCTTTTTAGG + Intergenic
1130001390 15:80050215-80050237 CTGGCAAATGCTGATTTATTTGG - Intergenic
1131401357 15:92128108-92128130 CTGGCCAATGATGCCAGCTTGGG - Intronic
1133289431 16:4709242-4709264 CTGGCTAATTTTGCATTTTTGGG - Intronic
1133681138 16:8121038-8121060 TAGGCCAATGATGCCATTTTGGG - Intergenic
1134147816 16:11781333-11781355 TTGGCAAATGATGGCCTTGTGGG - Intronic
1134232174 16:12437779-12437801 CTGGCACTTAATGTCTTTTTCGG + Intronic
1135167959 16:20157098-20157120 GTGGCAAATGAGGCATTTGTTGG - Intergenic
1135940161 16:26815481-26815503 GTGGCAAGAGATGCCTTTTGGGG - Intergenic
1140278934 16:73536403-73536425 TTAGCGAATGATGACTTTTTGGG - Intergenic
1140744192 16:77966548-77966570 CTGGTAACTGTTGCCTTTTCTGG - Intronic
1141922307 16:87144187-87144209 CTGGCTCATTCTGCCTTTTTGGG + Intronic
1142315621 16:89342924-89342946 CATGTAAATGATGCCTGTTTTGG - Intronic
1152967687 18:131648-131670 CTGCCAATTGTTACCTTTTTTGG - Intergenic
1154943959 18:21142308-21142330 CTGGCTTATGCTGCCTTGTTAGG - Intergenic
1155505362 18:26527729-26527751 GTGGTAAATTGTGCCTTTTTGGG + Intronic
1159197046 18:65130446-65130468 CTGGCAATTTATGTCTTTCTAGG + Intergenic
927957317 2:27217018-27217040 CTGGCGAAAGATGCCTTTCTAGG - Exonic
930380875 2:50626322-50626344 CTGGCATATCATGGCTATTTGGG - Intronic
931650263 2:64462298-64462320 CTGGCAGATGAGGCCTGTTAAGG + Intergenic
932694201 2:73940443-73940465 CTGGCATATCATGCCTATTGAGG + Intronic
932966253 2:76478755-76478777 CAGGCAAAGGATGCGTTTCTTGG + Intergenic
933711200 2:85327399-85327421 CTTGCTAGTGCTGCCTTTTTGGG + Exonic
935049512 2:99512651-99512673 TTGGCTAATGTTGCCTTTTTTGG + Intergenic
935171697 2:100615145-100615167 CTGGCAACTTTTGCCTTTATGGG + Intergenic
935356573 2:102207102-102207124 GTGGCAAATGCTGCCTTCCTGGG + Intronic
937569194 2:123334880-123334902 CTGGCAAAGGAGGGGTTTTTAGG - Intergenic
937750123 2:125466867-125466889 CTCGAAAATGGTGCCTTTTTCGG - Intergenic
938091257 2:128436288-128436310 CTGGCAGATGGTGCCATTTCTGG + Intergenic
939617443 2:144377107-144377129 CTGGCAAATGCTACCATTTAAGG + Intergenic
941736457 2:168982054-168982076 GTGACAAATGATGGCTTATTGGG - Intronic
943250096 2:185509158-185509180 TTGGCAAATTATGTCTTTTGAGG + Intergenic
945674822 2:212843493-212843515 CAGCGAAATGATTCCTTTTTTGG - Intergenic
1169248763 20:4044650-4044672 CTGGCAACTGCCGCCCTTTTGGG + Intergenic
1169363108 20:4968296-4968318 GTGGCATATGATGCGTCTTTTGG + Intronic
1170153426 20:13248721-13248743 ATGGCATATGATGACTTTTGAGG + Intronic
1170598914 20:17825959-17825981 CTGGCAAAAGATGCTGTCTTGGG + Intergenic
1173300316 20:41796626-41796648 CTGGGAAATGATGCCATCTGGGG + Intergenic
1174983511 20:55423371-55423393 CTGGCACTTGATGCCTTAATAGG - Intergenic
1175132644 20:56801092-56801114 CTGGCCAAGGCTGCCTTTTCTGG + Intergenic
1175139766 20:56852324-56852346 TTGACAGATGATGCTTTTTTAGG + Intergenic
1177001247 21:15615881-15615903 TTGTTAAATGATGTCTTTTTAGG + Intergenic
1182038679 22:27219305-27219327 CTGCCAAATGTTGTCTTTATTGG + Intergenic
1182806879 22:33079896-33079918 CAGGCCAATGATGCCATTGTCGG - Intergenic
1182815855 22:33162694-33162716 TTGGCACATGAAGCCTTTTCGGG + Intronic
1183213595 22:36465669-36465691 GTGGCAAACGGTGCCTTTTAAGG + Intergenic
951651405 3:24955384-24955406 CACCCAAATGTTGCCTTTTTTGG - Intergenic
956991434 3:74770906-74770928 CTGGCACATAATGCCTTAGTCGG + Intergenic
957517121 3:81269713-81269735 CTGGAATATAATGCCCTTTTTGG - Intergenic
959640044 3:108622462-108622484 TTGGCAACTGGTGCCTTTTTTGG + Intronic
960094072 3:113671236-113671258 TGGGCAAATGAGGCCTTTCTAGG + Intronic
960549412 3:118957458-118957480 CTGGCAAATTGTGTCTTTTAAGG + Intronic
960597946 3:119423613-119423635 CTGGCAAATAATAGCTTTTAAGG - Intergenic
963064105 3:141249281-141249303 TTGCCCAATGAGGCCTTTTTAGG - Intronic
965551845 3:169973961-169973983 CTAACAAATTATTCCTTTTTGGG + Intronic
966526493 3:180924811-180924833 CTGACAACTGATGCTGTTTTAGG - Intronic
967518681 3:190402142-190402164 CTGACAATTGAAGCCTTTCTGGG - Intronic
967675112 3:192288954-192288976 CTCGGACATGAGGCCTTTTTTGG - Intronic
970336889 4:15056528-15056550 CTGGCAAATCATAGTTTTTTTGG + Intronic
970745096 4:19284626-19284648 CTTGTAAATGCTGCCTTATTTGG + Intergenic
971368039 4:25993381-25993403 CTTGCAAATGTGACCTTTTTTGG - Intergenic
971392564 4:26199714-26199736 CTGGCAAGTGGTTTCTTTTTGGG + Intronic
973803582 4:54502220-54502242 CTGCCAGAGGATGCCTTTTGTGG + Intergenic
976393225 4:84527341-84527363 CTTGTAAAAGATGCCTTCTTAGG + Intergenic
979090901 4:116480934-116480956 CTTGCAAATGATGTTCTTTTTGG - Intergenic
979235687 4:118397757-118397779 CTGGAAAATCATGCCTTCTCTGG + Intergenic
979257385 4:118619377-118619399 CTGGCTAATGTTTCTTTTTTTGG + Intergenic
979330966 4:119421171-119421193 CTGGCTAATGTTTCTTTTTTTGG - Intergenic
984451218 4:179905508-179905530 CTAGCAAATCATGACTTTTCAGG + Intergenic
986146040 5:5078850-5078872 CTGGCACAGGCTGCCTTTTGAGG - Intergenic
986324685 5:6663474-6663496 CTGGAAAATGATGTCATTTTAGG - Intronic
988567975 5:32335482-32335504 CTAACAAATGATGTATTTTTAGG + Intergenic
991277537 5:64867579-64867601 CTGGCAAAGAAAGCCTTGTTAGG + Intronic
994181289 5:96769273-96769295 CTCGTAAGTAATGCCTTTTTTGG + Intronic
998961733 5:147494971-147494993 TTGGCAAATTATGCCTTTCGAGG - Intronic
999907034 5:156152905-156152927 ATGTCACCTGATGCCTTTTTTGG - Intronic
1000322512 5:160146052-160146074 CTGGAAAATAATGGGTTTTTGGG + Intergenic
1001002250 5:168018656-168018678 CTGGAAACTGATGACTTTTTAGG + Intronic
1001555867 5:172636885-172636907 CTGAAAAATGATGCTTTTTCAGG + Intergenic
1001687439 5:173604760-173604782 CTGGCAGATGTTGCTTGTTTAGG - Intergenic
1003524431 6:6886169-6886191 CTGGCTAAAGAGGCCTTTTATGG + Intergenic
1003991979 6:11495129-11495151 CTGGCAAAGGCTGTCTTCTTTGG - Intergenic
1004142452 6:13031595-13031617 CTGGGAAGGGATGACTTTTTAGG + Intronic
1004806800 6:19211454-19211476 CTGGCAAATGACGCCTAACTAGG - Intergenic
1007089323 6:39172410-39172432 CTGGCAATGGCTGCCTTTTGGGG + Intergenic
1007651773 6:43427107-43427129 CGGACAAATAATGCCATTTTGGG - Intergenic
1009546198 6:65022295-65022317 CTGGCATAATATGCCTCTTTTGG - Intronic
1010118670 6:72346537-72346559 CTGGCAGATTATGCCTAATTTGG - Intronic
1011343159 6:86339977-86339999 CTGGCAAATGCTGCCACTGTGGG + Intergenic
1012971972 6:105740964-105740986 CTGGCATATGAAGCCTATTTGGG - Intergenic
1014016746 6:116539812-116539834 CTGGCTAAAGATGCATTTTCCGG + Intronic
1014615963 6:123600113-123600135 ATGCCACATGATGCCTTTTATGG + Intronic
1014930971 6:127335629-127335651 CTGGCAACTGGTGACTTTTTTGG - Intronic
1019671814 7:2283955-2283977 CTGGCTAATTTTGCATTTTTAGG + Intronic
1020502014 7:8935239-8935261 CTGGTAAATGAAGCCTTACTGGG + Intergenic
1021545531 7:21809276-21809298 CTGGTTATTGATGCCTTGTTGGG + Intronic
1022181021 7:27920176-27920198 TTGGCAACTGATGCCTCTTGGGG + Intronic
1024072306 7:45796458-45796480 CTGGCTAATGTTTCTTTTTTTGG + Intergenic
1024883915 7:54120115-54120137 TTGGAAAATAATGCTTTTTTAGG - Intergenic
1028013971 7:85683981-85684003 CTGGCAAAGGCTACCTTCTTTGG + Intergenic
1028821295 7:95214776-95214798 TTGGCAAATAATGATTTTTTTGG + Intronic
1030233268 7:107230359-107230381 CTGGTAAATTATGCTTTTCTTGG - Intronic
1032049694 7:128640147-128640169 CTGGCTAATGTTTCTTTTTTTGG + Intergenic
1033726375 7:144123143-144123165 CTCGCTAATGAGGCCTTCTTGGG - Intergenic
1039147880 8:34469762-34469784 TTGCCTAATGATGCATTTTTTGG + Intergenic
1042878182 8:73459361-73459383 CTGGAAAAATATGGCTTTTTTGG - Intronic
1043371997 8:79605823-79605845 GCGGCAAATGCTGCCTTTTGAGG - Intergenic
1045147360 8:99361732-99361754 CTGGAACATGATGCCTGTATAGG + Intronic
1045362714 8:101448081-101448103 GTGGCAAATGTTGCATTCTTTGG + Intergenic
1046940508 8:119926208-119926230 CTGGCAAATGAAGCCTAGTCTGG + Intronic
1047188698 8:122658541-122658563 CTGGCAAATTTTACCTTTTATGG - Intergenic
1047861814 8:128975642-128975664 CTTGCAAATGATGCTTTGTAAGG + Intergenic
1047944856 8:129865560-129865582 CTGAGAAATGATGGCATTTTTGG - Intronic
1049927903 9:427414-427436 TTGACAAATGATGTCTTCTTTGG + Intronic
1050218994 9:3364515-3364537 CAGGCAGATGATGCCATATTTGG + Intronic
1051392032 9:16575706-16575728 CTGGCACAGGAGGCTTTTTTGGG - Intronic
1051409242 9:16771762-16771784 TTAGCAAAAGATGCCTTTCTAGG - Intronic
1051565709 9:18495558-18495580 CTGGCAAATTTTGCAGTTTTGGG - Intronic
1052605043 9:30688669-30688691 GTGGCAAATGTTGCTTTATTGGG - Intergenic
1052755017 9:32532121-32532143 CTGTCAAATGATTCCATTTCTGG - Intergenic
1054803203 9:69373304-69373326 CTGACAAATGAAACCTTTTTGGG + Intronic
1055336868 9:75240577-75240599 CTGTGAACTGATGCCTTCTTAGG - Intergenic
1059586497 9:115613036-115613058 GTGATAAATGATGCCTTTCTGGG - Intergenic
1060285128 9:122244329-122244351 CAGGAAAGTGATGCCTATTTGGG - Intronic
1060655953 9:125372999-125373021 CTGACACATGATGCCTTTCTGGG + Intergenic
1187384266 X:18833107-18833129 CAGCCAAATGTTGCCGTTTTTGG + Intergenic
1188385121 X:29547071-29547093 AGGGCAAATGCTGACTTTTTTGG - Intronic
1189247773 X:39576732-39576754 CTGGCAAACGGTGGCTTTCTGGG + Intergenic
1190940748 X:55038288-55038310 TTGACAAATGATGCTTTTTTAGG - Intergenic
1191033181 X:55997255-55997277 CTGGCTAATGATGCTTCTCTAGG - Intergenic
1193313616 X:80038527-80038549 CTAACAAATGATGCCCTTTTAGG + Intergenic
1193928342 X:87519462-87519484 CAGCAAAATGATGCCTTTATAGG + Intronic
1194050892 X:89067333-89067355 TAGAAAAATGATGCCTTTTTTGG + Intergenic
1195810769 X:108826167-108826189 CAGGGAAGTGATGCCTTTATAGG + Intergenic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic
1199456967 X:148039974-148039996 CTGGCTAATGATGCATCATTAGG + Intergenic
1199541892 X:148966802-148966824 GTGGCAGAGGATGCCTTTTTTGG - Exonic