ID: 1077915967

View in Genome Browser
Species Human (GRCh38)
Location 11:6611867-6611889
Sequence GGGTATAGACAGACCTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 71}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077915967_1077915971 -2 Left 1077915967 11:6611867-6611889 CCCAGCTAGGTCTGTCTATACCC 0: 1
1: 0
2: 0
3: 9
4: 71
Right 1077915971 11:6611888-6611910 CCTCTGCCCTCACCCGCCGCTGG 0: 1
1: 0
2: 5
3: 32
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077915967 Original CRISPR GGGTATAGACAGACCTAGCT GGG (reversed) Intronic
903279879 1:22244367-22244389 GGGGCCAGACAGACCTAACTTGG + Intergenic
908095571 1:60733574-60733596 GGGAATAAACAAACCTGGCTAGG - Intergenic
911642430 1:100303439-100303461 GGGCATAGCCACACCAAGCTTGG - Intergenic
912789213 1:112635219-112635241 GGATTTAGACAGACCAAGATAGG + Intronic
916696946 1:167247732-167247754 TGGAAAAGACAAACCTAGCTTGG + Intronic
916923963 1:169498249-169498271 ACATATACACAGACCTAGCTGGG - Intergenic
918044140 1:180931190-180931212 GGGGATAGACATGCCTAGATTGG + Intronic
920061015 1:203227045-203227067 GGGTACAGACAGACCCTGCTGGG - Intronic
1069369019 10:67724214-67724236 TGGTATAAACAGTCTTAGCTTGG - Intergenic
1069917473 10:71796287-71796309 GGGACTGGACAGACCTAGTTTGG - Intronic
1077915967 11:6611867-6611889 GGGTATAGACAGACCTAGCTGGG - Intronic
1086502547 11:87468305-87468327 GGGAAGAGACAGAGCTAGATAGG + Intergenic
1087613470 11:100461688-100461710 GGGGATATACAGACCTATATGGG - Intergenic
1088885388 11:114001946-114001968 AGGTATAGACATACGTAGGTGGG + Intergenic
1091823703 12:3493842-3493864 GGGGAGGGACAGACCCAGCTGGG + Intronic
1102224027 12:111215314-111215336 GGGAATAGGCAGACCCAGCCAGG + Intronic
1105541689 13:21321519-21321541 AGGTAGAGGCAGACCTATCTGGG - Intergenic
1113333721 13:109357643-109357665 GGATCTAGACAGACCTAGTGGGG - Intergenic
1114227212 14:20749836-20749858 GGGTATAGGCAGAGCTGACTGGG + Intergenic
1120102467 14:80461158-80461180 GGGCATTGACAGACCTGGCTCGG - Intergenic
1120437468 14:84498803-84498825 TGGGCAAGACAGACCTAGCTGGG + Intergenic
1129723287 15:77889332-77889354 GGGACTAGACTGACCTTGCTTGG - Intergenic
1130233376 15:82113444-82113466 GGCTAAAGACAGACCTGGCCTGG - Intergenic
1131144184 15:90000923-90000945 GGGAAGAGGCAGACCTCGCTTGG - Intergenic
1133270911 16:4610425-4610447 GCTTATACACAGAACTAGCTCGG + Intronic
1133646509 16:7769708-7769730 CAGAATAGACAGACCTTGCTGGG - Intergenic
1137677726 16:50311948-50311970 AGGGACAGACAGACCTGGCTAGG + Intronic
1138231398 16:55339455-55339477 GGATAAAGTCAGACCAAGCTGGG + Intergenic
1148846205 17:50531623-50531645 GAGGACAGACAGACATAGCTGGG + Intergenic
1158884450 18:61812933-61812955 AGATATAGACAGACCTAGGATGG + Exonic
1162793789 19:13076405-13076427 GGGTGCAGACAGACCTAGAGAGG + Intronic
937241153 2:120463499-120463521 GGGTATGAACAGACATAGATGGG - Intergenic
941751660 2:169141083-169141105 GAGTATGTACAGGCCTAGCTGGG - Intronic
942477761 2:176346203-176346225 GGGTATAGACAGCCCTAAGTTGG - Intergenic
946030597 2:216701009-216701031 GGGTTTAGATTGACCCAGCTGGG - Intergenic
1177974350 21:27828642-27828664 GGGTCAAGAAAGACCTATCTTGG - Intergenic
1183026148 22:35067120-35067142 GGGTATGGAGAGAAATAGCTTGG + Exonic
1183621453 22:38975287-38975309 GGGTAGAGACCTACCTGGCTGGG - Intronic
1185045762 22:48528038-48528060 CGGCATAGACAGAGCTGGCTTGG + Intronic
949966319 3:9359538-9359560 CTGAATAGACAGACCTTGCTGGG - Intronic
953982486 3:47419654-47419676 TGGTATACACAGACCCAGCAGGG - Exonic
954662419 3:52233156-52233178 GGGTATACACAGGTCTAGCCTGG + Intronic
962119197 3:132544296-132544318 GAGTCTAAACAGACCTTGCTGGG - Intergenic
964945506 3:162218877-162218899 GGGTATAGAATGAACTAGCTGGG + Intergenic
968433249 4:571924-571946 GGGTGCACAGAGACCTAGCTGGG - Intergenic
976456903 4:85258147-85258169 GGGTATGGTCAGACGTTGCTAGG - Intergenic
977423712 4:96837880-96837902 GGGTCCAGAGAGAGCTAGCTAGG + Intergenic
979045566 4:115858352-115858374 GGGTGTATACAGACCTCTCTTGG + Intergenic
983995995 4:174182740-174182762 GGGTATAGAAATAACTAGATTGG - Intergenic
989181356 5:38580560-38580582 GGGTGGAGACAGATCTAGGTGGG - Intronic
992490944 5:77244182-77244204 GGTTTTAGAAAGACTTAGCTTGG + Intronic
994139475 5:96325891-96325913 GGGTATACAAAGACCCAACTTGG + Intergenic
994332751 5:98526587-98526609 AGGTAGAGAGAGACCTAGATTGG - Intergenic
994958822 5:106571426-106571448 GGGTTTACACAGACATAGATGGG + Intergenic
1003402729 6:5804212-5804234 GGGCACAGACAGAACCAGCTTGG - Intergenic
1005475397 6:26203128-26203150 GAATATAGACAGGCCTTGCTGGG - Intergenic
1012783683 6:103595725-103595747 GGGTATAGACAGATATAGGTAGG + Intergenic
1013140576 6:107329810-107329832 GGGTATAGAAGTACCTAGCAGGG - Intronic
1013341937 6:109223521-109223543 GGTTCTACACAGGCCTAGCTGGG - Intergenic
1024186539 7:46953883-46953905 GCATATAGACAGATATAGCTTGG + Intergenic
1024931495 7:54669252-54669274 AGCAAAAGACAGACCTAGCTTGG + Intergenic
1026473699 7:70716193-70716215 GGTAATAGACGGACCTGGCTAGG - Intronic
1028198805 7:87936569-87936591 GGGTATAGACAAAACAAGATTGG - Intronic
1029887457 7:103888301-103888323 AGGTATAGAGAGACCTAGAGAGG + Intronic
1029980872 7:104877760-104877782 GGGTATATACATACCCAGCATGG - Intronic
1037802989 8:22045136-22045158 GGGTAACGAGAGACCTAGCTGGG + Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1040025029 8:42774047-42774069 TGATATAGACAGACCTAGATTGG - Intronic
1044339028 8:91025810-91025832 GGTTAGGGACAGACTTAGCTTGG + Intronic
1045341032 8:101254622-101254644 GAATCTAGACAGACCTTGCTGGG + Intergenic
1050772239 9:9216659-9216681 GGGTCTAGAAAGACCAAGCTTGG + Intronic
1051657783 9:19399095-19399117 GGGTATAGACAGAGCAACATTGG - Intergenic
1053080674 9:35173819-35173841 GGTTTTAGACAGACATGGCTTGG + Intronic
1054465401 9:65490408-65490430 GGGTATATACAGAGCTGTCTGGG + Intergenic
1055928327 9:81533505-81533527 GGGTATAGTCAGAGCTAGCAAGG - Intergenic
1185699034 X:2216444-2216466 GGGTATAGACAGATCTTTTTGGG - Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1190094033 X:47464471-47464493 GGGTATAGGCAGAGATACCTAGG - Intronic
1190310933 X:49116594-49116616 GGGTACAGACAGAGCTCTCTGGG - Intronic
1194280407 X:91945830-91945852 GGGTATAGAAAGTCCAAGATGGG - Intronic
1200597884 Y:5169358-5169380 GGGTATAGAAAGTCCAAGATGGG - Intronic