ID: 1077916024

View in Genome Browser
Species Human (GRCh38)
Location 11:6612039-6612061
Sequence CAGCCCCGCGGGGACAGCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 231}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077916024_1077916032 -7 Left 1077916024 11:6612039-6612061 CCCCCGCTGTCCCCGCGGGGCTG 0: 1
1: 0
2: 2
3: 13
4: 231
Right 1077916032 11:6612055-6612077 GGGGCTGGCCTTGTTCTCCGCGG 0: 1
1: 1
2: 3
3: 21
4: 269
1077916024_1077916039 14 Left 1077916024 11:6612039-6612061 CCCCCGCTGTCCCCGCGGGGCTG 0: 1
1: 0
2: 2
3: 13
4: 231
Right 1077916039 11:6612076-6612098 GGCGGTGCTGGAGGGCAGCGCGG 0: 1
1: 0
2: 3
3: 48
4: 537
1077916024_1077916042 30 Left 1077916024 11:6612039-6612061 CCCCCGCTGTCCCCGCGGGGCTG 0: 1
1: 0
2: 2
3: 13
4: 231
Right 1077916042 11:6612092-6612114 AGCGCGGCGGGAGCCGAGACCGG 0: 1
1: 0
2: 1
3: 9
4: 115
1077916024_1077916037 6 Left 1077916024 11:6612039-6612061 CCCCCGCTGTCCCCGCGGGGCTG 0: 1
1: 0
2: 2
3: 13
4: 231
Right 1077916037 11:6612068-6612090 TTCTCCGCGGCGGTGCTGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 61
1077916024_1077916033 -4 Left 1077916024 11:6612039-6612061 CCCCCGCTGTCCCCGCGGGGCTG 0: 1
1: 0
2: 2
3: 13
4: 231
Right 1077916033 11:6612058-6612080 GCTGGCCTTGTTCTCCGCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 85
1077916024_1077916040 17 Left 1077916024 11:6612039-6612061 CCCCCGCTGTCCCCGCGGGGCTG 0: 1
1: 0
2: 2
3: 13
4: 231
Right 1077916040 11:6612079-6612101 GGTGCTGGAGGGCAGCGCGGCGG 0: 1
1: 0
2: 2
3: 52
4: 483
1077916024_1077916035 2 Left 1077916024 11:6612039-6612061 CCCCCGCTGTCCCCGCGGGGCTG 0: 1
1: 0
2: 2
3: 13
4: 231
Right 1077916035 11:6612064-6612086 CTTGTTCTCCGCGGCGGTGCTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1077916024_1077916041 18 Left 1077916024 11:6612039-6612061 CCCCCGCTGTCCCCGCGGGGCTG 0: 1
1: 0
2: 2
3: 13
4: 231
Right 1077916041 11:6612080-6612102 GTGCTGGAGGGCAGCGCGGCGGG 0: 1
1: 0
2: 2
3: 33
4: 314
1077916024_1077916036 5 Left 1077916024 11:6612039-6612061 CCCCCGCTGTCCCCGCGGGGCTG 0: 1
1: 0
2: 2
3: 13
4: 231
Right 1077916036 11:6612067-6612089 GTTCTCCGCGGCGGTGCTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077916024 Original CRISPR CAGCCCCGCGGGGACAGCGG GGG (reversed) Exonic