ID: 1077922617

View in Genome Browser
Species Human (GRCh38)
Location 11:6653102-6653124
Sequence GTGGCCTCCTAGACCCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077922615_1077922617 9 Left 1077922615 11:6653070-6653092 CCATTATTCTTGGGTTAAATGAA 0: 1
1: 0
2: 5
3: 91
4: 371
Right 1077922617 11:6653102-6653124 GTGGCCTCCTAGACCCTGCATGG 0: 1
1: 0
2: 1
3: 19
4: 181
1077922612_1077922617 28 Left 1077922612 11:6653051-6653073 CCAATGATTTGGTGACTCTCCAT 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1077922617 11:6653102-6653124 GTGGCCTCCTAGACCCTGCATGG 0: 1
1: 0
2: 1
3: 19
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077922617 Original CRISPR GTGGCCTCCTAGACCCTGCA TGG Intronic
900181104 1:1311332-1311354 GCTGCCTCCTGCACCCTGCAGGG + Exonic
900515116 1:3078098-3078120 GAGGCCTCCTAGTTCTTGCAGGG + Intronic
900576617 1:3385742-3385764 GGGGCCTCCTAGAGCCTCCGGGG + Intronic
900780700 1:4615601-4615623 GAGGCCTCCGAGACCCTCCCTGG - Intergenic
901012858 1:6210973-6210995 GTGGCCTCCACTGCCCTGCAGGG - Intronic
901033036 1:6319606-6319628 GTGGCCACATAGTCCCTACATGG - Intronic
902330187 1:15727508-15727530 GCGGCCACCATGACCCTGCAGGG + Exonic
902520134 1:17011405-17011427 GTGGCCTCCCCGTCCCCGCACGG + Intronic
902584135 1:17427731-17427753 GTGGCATCCTGGGCACTGCAGGG - Intronic
902679108 1:18030614-18030636 GTGGCATTCCAGAACCTGCAGGG + Intergenic
903042268 1:20540209-20540231 CTGGCCCCCAAGACTCTGCAAGG - Intergenic
903690687 1:25171344-25171366 TTGGCCTACAAGATCCTGCATGG + Intergenic
904107022 1:28093711-28093733 TTTGCCTACTTGACCCTGCATGG + Intergenic
905108018 1:35575431-35575453 GAGGCCTCCAAGGCCCTGCCTGG - Intronic
905765236 1:40595227-40595249 GGGGCCTCCTGGGCCCTGCCAGG + Intergenic
906154621 1:43606686-43606708 CTGGTCTCCCAGACCCTACAAGG - Intronic
912228962 1:107770031-107770053 GTGGGCTTCTAGGCCATGCAAGG - Intronic
915444022 1:155964569-155964591 TTGGCCTACAAGACCCTGCCTGG - Intronic
918042199 1:180920201-180920223 GTGGTCCCCAAGACCCTGCAGGG + Intronic
920057700 1:203204959-203204981 GTGGCCTCTGAGTCACTGCAGGG + Intergenic
923025471 1:230200454-230200476 GTGTCATGCTAGATCCTGCAGGG - Intronic
924627179 1:245705202-245705224 GTGGCCTGCGAGATCCTGCGAGG - Intronic
1071869666 10:89780578-89780600 GAGGGCTCCTAAACCCTGGATGG + Intergenic
1073072720 10:100805148-100805170 CTGGCCTCCCAGACCGAGCATGG - Intronic
1074764036 10:116687346-116687368 GAGGCCTCCCAGACACTGCCTGG - Intronic
1076306594 10:129469566-129469588 TGAGCCTCCCAGACCCTGCAGGG + Intronic
1077035553 11:492802-492824 TTGGCCTCCGTGGCCCTGCACGG + Intergenic
1077405387 11:2380208-2380230 GTGTCCTTCTGGACCCTGCAGGG - Intronic
1077922617 11:6653102-6653124 GTGGCCTCCTAGACCCTGCATGG + Intronic
1081613535 11:44577526-44577548 ATGCCCTGCCAGACCCTGCAGGG - Intronic
1083324540 11:61866643-61866665 GTGCCCTCCTGCAGCCTGCAGGG - Exonic
1083945907 11:65922461-65922483 GGGGCCTCCTGGAGCCCGCAAGG + Intergenic
1085021615 11:73213582-73213604 GCTGCCTCCTAGACCCTACCTGG - Intergenic
1087156530 11:94910045-94910067 GTGGCCCACAAGACCCTGCAAGG - Intergenic
1088917887 11:114240902-114240924 GTGGTTTGCAAGACCCTGCATGG + Intronic
1091224106 11:133947270-133947292 GTGGCCTCCCTGGCCCTGCCTGG - Intronic
1091398568 12:169387-169409 CTGGCATCCTGGCCCCTGCAGGG + Intronic
1092400243 12:8169789-8169811 GTGACCTCCTAGCCCTTTCACGG - Intronic
1100299557 12:93294536-93294558 TTGGCCAGCCAGACCCTGCATGG - Intergenic
1100890841 12:99124019-99124041 GTGGTTTCCAAGACCCTGCATGG - Intronic
1101023281 12:100574348-100574370 TGGGCGTTCTAGACCCTGCATGG - Intronic
1101828070 12:108236265-108236287 GTGGTCTCCCAGACCCTCCTAGG + Intronic
1102956956 12:117065064-117065086 GTGTCCTTCTGGCCCCTGCACGG - Intronic
1103031739 12:117620280-117620302 ATGGGCTCCTAGACCCTGGGTGG + Intronic
1104432470 12:128727733-128727755 GTGGCCTGCCAGCCCTTGCAGGG + Intergenic
1105387622 13:19946299-19946321 GTGGCCTCCAAGGCCTTCCAGGG + Intergenic
1106289111 13:28344174-28344196 ATGGCCTACGAGACCCTGCCTGG + Intronic
1107540157 13:41382024-41382046 GTGGCTTCATAGCCCCTGAACGG + Intergenic
1107732482 13:43362442-43362464 GTGCCCTCCTCTACTCTGCAAGG + Intronic
1110145739 13:72188203-72188225 ATGGCCTTTAAGACCCTGCATGG + Intergenic
1118731635 14:68670930-68670952 GTGGGCTCACAGACCCTCCAAGG + Intronic
1121240615 14:92427411-92427433 TTGGCCTTCAAGGCCCTGCACGG - Intronic
1123147999 14:106152828-106152850 GTGGACTGCTAGACCATGGAGGG + Intergenic
1126170742 15:45693312-45693334 AAGCCTTCCTAGACCCTGCAGGG - Intergenic
1127642488 15:60929092-60929114 GGGGCCTTGTAGACCCAGCAGGG - Intronic
1129723998 15:77892365-77892387 CTGGCCTCCTTGGCCTTGCAAGG + Intergenic
1130117090 15:81014677-81014699 GTGGCTTCCAAGGCCCTGGATGG + Intronic
1130204818 15:81866033-81866055 GTGTCCGCCCAGACCCTGCAAGG + Intergenic
1131425997 15:92345913-92345935 ATGGTGTCCTGGACCCTGCAGGG + Intergenic
1131558778 15:93421793-93421815 GTGACCTCCAAGAGCATGCACGG + Intergenic
1132348101 15:101120817-101120839 GTGGCCCCCAAGACCCTCCAGGG + Intergenic
1132608868 16:805273-805295 TTGGCCTCTAAGACCCTGGATGG + Intergenic
1136049054 16:27637739-27637761 GTGGTCTTCTAGGCCCTGCATGG - Intronic
1136080478 16:27849282-27849304 GTGGGCTCCAGGGCCCTGCATGG - Intronic
1136482863 16:30553473-30553495 TAGCCCTCCTAGACCCTGCCAGG - Intronic
1139486182 16:67257776-67257798 GTGGCCTGCTTGGCCCTGCATGG + Intronic
1141881827 16:86865330-86865352 GTGCCCTCCCAGCCCCTGCAGGG - Intergenic
1142399254 16:89850682-89850704 CTGGCCTCCCGGACCCTCCACGG - Intronic
1142427996 16:90010991-90011013 GCTGCTTCCTGGACCCTGCATGG + Intronic
1142755836 17:2015904-2015926 GTGGCTTCCTATATCCTGCTAGG + Intronic
1144873199 17:18382911-18382933 GTGGCCGCCCGGACCCTGCCCGG + Intronic
1145867389 17:28249976-28249998 GCGGCCCCCTATACTCTGCACGG + Intergenic
1146289422 17:31597150-31597172 GGGACCTCCCTGACCCTGCAGGG + Intergenic
1147044658 17:37743900-37743922 GTGTCCACCCGGACCCTGCATGG + Intronic
1148393217 17:47288596-47288618 ATGGGATCCTAGACCTTGCAGGG - Intronic
1149569927 17:57665155-57665177 GTGGCCTTCCTGACCCTGCTGGG - Intronic
1150231049 17:63550669-63550691 GTGGCCACCATGTCCCTGCACGG + Exonic
1150294071 17:63998604-63998626 GTGGCCTCCCTAACCCCGCAGGG - Intronic
1151313702 17:73309785-73309807 GGCCCCTCCTAGTCCCTGCAGGG + Intronic
1151545969 17:74793347-74793369 TTTGCCTCCCAGACCCTGCTGGG - Intronic
1151748042 17:76022120-76022142 GTGGCCGCCCGGACCCTGCCCGG - Intronic
1152782233 17:82231508-82231530 GAGGCCTCCTGGACCCCGCAAGG - Intronic
1153772174 18:8425055-8425077 GTGGCCTCCCTGAGGCTGCACGG + Intergenic
1154144681 18:11857311-11857333 GTGGCTTCCCAGAGCCAGCAGGG + Intronic
1160686274 19:438434-438456 GGGGCGTCCTGGCCCCTGCAGGG + Intronic
1161166226 19:2789268-2789290 CTGGCCCCCTGGGCCCTGCACGG + Intronic
1161274925 19:3410574-3410596 GTGGCCCACAAGGCCCTGCATGG - Intronic
1161393432 19:4032829-4032851 GTGGCCTCCCCCACCCTGCGTGG - Intronic
1163093325 19:15036340-15036362 GAGGCCTTCTAGAACCTGAAAGG - Intergenic
1163637276 19:18443165-18443187 GAGGCCTCCTGGAGCCTGCTCGG + Exonic
1165353913 19:35292127-35292149 GTGGGGGCCTAGACCCTGGAAGG + Exonic
1165736977 19:38183154-38183176 GTGGCCCTCAAGACCCTCCATGG - Intronic
1167049582 19:47070214-47070236 GTGGCCGCCTAGATCCTCCTGGG + Intronic
925466699 2:4112411-4112433 GTCACCTACGAGACCCTGCAAGG + Intergenic
925973306 2:9123105-9123127 GAGGCTTCCTAGACCCTCCGAGG + Intergenic
926878811 2:17518199-17518221 GTTGTCCCCTAGACCCTTCAAGG - Exonic
927702251 2:25275985-25276007 GCGGCCTCCCTGGCCCTGCAAGG + Intronic
930036291 2:47087372-47087394 GGGGCCACCTAGAACCTGCTGGG + Intronic
932475070 2:72000398-72000420 GTGGCCTCCGAGGCCCTACTGGG + Intergenic
933806914 2:86005209-86005231 GTGGCCTCTAAGGCCTTGCATGG - Intergenic
934104882 2:88686378-88686400 GTTGCCTGCTAGCCCTTGCAAGG - Intergenic
936084149 2:109455163-109455185 GTGGCCTCCTAGTCCCTGGGAGG + Intronic
936243436 2:110807069-110807091 GTGGCCCCCAAGACCCTCCTGGG - Intronic
937279820 2:120710072-120710094 GTGGGCCCCGAGACCCTGCTTGG + Intergenic
938458574 2:131482978-131483000 GTGGGACCCTAGAGCCTGCATGG + Intronic
938579907 2:132636377-132636399 GTGGGCTCCCAGACCCTGGGAGG - Intronic
941254976 2:163217558-163217580 GAGGCCTCTCAGACCATGCATGG - Intergenic
941539597 2:166766129-166766151 GTGGCCTGCTAGACCTTGGGAGG + Intergenic
948190385 2:236053658-236053680 TTGGCCCCCAAGGCCCTGCAGGG + Intronic
948706687 2:239798275-239798297 GTGGAGTCCTAGACCATGAATGG + Intronic
949050270 2:241894250-241894272 GTGGCCTCCGGGACCCTGTCTGG + Exonic
1170587947 20:17749773-17749795 GAGGCCTCCCAGCCTCTGCACGG + Intergenic
1170814957 20:19706000-19706022 CTGGCTTCCTGGAGCCTGCATGG - Intronic
1171332329 20:24351409-24351431 GTGACCTCCCAGACCCTGTCTGG + Intergenic
1173953700 20:47013720-47013742 GTGACCCCCAAGGCCCTGCATGG - Intronic
1174206932 20:48846994-48847016 GTGACCTCCTAGCCCCTGGAGGG - Intergenic
1174578767 20:51556182-51556204 GTTTCCTCCTAGAGCCTTCAGGG + Intronic
1175182095 20:57155832-57155854 GTGGCCTCCTATTGCCTTCATGG - Intergenic
1175218604 20:57404557-57404579 GAGGCCTCCGAGACCCTTCTGGG + Intronic
1175811473 20:61860722-61860744 GTGGCATCCAGGCCCCTGCAGGG + Intronic
1175862975 20:62159980-62160002 TTGGCCTCCTTTACCCAGCAAGG + Intronic
1176144018 20:63557536-63557558 GTGGCCTCCCAGAGCCAGCTCGG - Intergenic
1179584663 21:42366926-42366948 GTGGCCACCGTGACCTTGCAGGG + Intergenic
1180716071 22:17873280-17873302 ATGGCCTCCTGGACCGTGAAAGG - Intronic
1181534632 22:23535024-23535046 GTGGCCACCAGGACCTTGCAGGG - Intergenic
1181830264 22:25555004-25555026 GTGGCCTCCAAGGCCCTGCAGGG + Intergenic
1182770013 22:32788020-32788042 TTGGCCTTCTAGACCCAGCGTGG - Intronic
1183253813 22:36747901-36747923 CAGGCCTCCTAGCCCCTGCTGGG + Intergenic
1183297258 22:37037643-37037665 GAGGACTGCAAGACCCTGCATGG + Intergenic
1183466138 22:37981311-37981333 GTGGCTCCCTGGACCCTGGAGGG - Intronic
1183579845 22:38717451-38717473 GTGGCCTCCTGGAGCCTGGGAGG + Intronic
1183722778 22:39572101-39572123 GCAGCCTCCAAGGCCCTGCAGGG - Intronic
1184313544 22:43664779-43664801 CTGGCCTAGGAGACCCTGCATGG - Intronic
1184874385 22:47264015-47264037 TTGGGATCCGAGACCCTGCATGG + Intergenic
950076551 3:10191454-10191476 GTGGCCTACAAGGCCCTGCATGG + Intronic
952898179 3:38093080-38093102 GTGGCCTCCAAGACAGTCCAAGG + Intronic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
956459998 3:69462267-69462289 GCGGCCTCCTAGCCCCTCCATGG - Intronic
959295521 3:104530506-104530528 GTGGCCAACTAGACCCAGCCAGG + Intergenic
962084749 3:132178952-132178974 GTGGCCTCCTAGGCACTGTGTGG + Intronic
966809024 3:183827121-183827143 GTGGCCACCAAGACCCTCCATGG - Intergenic
967229474 3:187323947-187323969 GTGGCCCCTTAGGCCCTTCATGG - Intergenic
968073685 3:195804107-195804129 GTGCCCTCCTCGTCCCTGGATGG - Intronic
968554084 4:1238602-1238624 GTCCCCTCCGAGACCCTCCAAGG + Intronic
968606912 4:1539875-1539897 GTGGCCTCCTAGGGCCACCACGG - Intergenic
969410088 4:7022307-7022329 GAGGCCTGCCAGAGCCTGCAAGG + Intronic
973109728 4:46382490-46382512 GTGACCTGCAAGGCCCTGCAAGG - Intronic
979901846 4:126230667-126230689 ATGGCCTACAAGACCTTGCATGG - Intergenic
985220502 4:187698497-187698519 GTGGCCTCCCACACTCTTCAAGG + Intergenic
985656769 5:1135951-1135973 GTGGCCTCGTCGGCCCTGCGGGG + Intergenic
985810291 5:2078205-2078227 GAGGCAGCCTAGGCCCTGCACGG - Intergenic
990504105 5:56427675-56427697 ATGGCCTCCAAGGCCCTACATGG + Intergenic
990694393 5:58399743-58399765 TTCACCTCCTGGACCCTGCATGG + Intergenic
994988483 5:106968239-106968261 GTGGGCTCCTAGACCCTTTTGGG - Intergenic
995179695 5:109219380-109219402 GGGTCCTCCTGCACCCTGCAGGG + Intergenic
995461687 5:112410404-112410426 AGGGCCTCCTAATCCCTGCAAGG - Intronic
996833620 5:127767232-127767254 GTGGAATCCTAGATCCTACAGGG - Intergenic
997638367 5:135432110-135432132 GTGAGCCCCTGGACCCTGCATGG - Intergenic
1000514664 5:162225379-162225401 CTGGCATCCTGGACACTGCATGG - Intergenic
1002500255 5:179643372-179643394 GTGGCATCCTAGGCCCTGGTAGG + Intronic
1003730809 6:8821479-8821501 GTGGCCTGCCAGCCTCTGCAAGG - Intergenic
1006742015 6:36315646-36315668 TTGGCCTCCTTGTCCCTGCCTGG - Intergenic
1006831445 6:36970581-36970603 TTGGCCTCCTAGGCCCCGCTTGG + Intronic
1006878862 6:37321747-37321769 GTGGAGTCCTAGAGCCTGCTTGG + Intronic
1007962688 6:45974810-45974832 GTGGTGTCCCAGAGCCTGCAGGG - Intronic
1009994082 6:70879915-70879937 ATGGCCTCCCAGGCCCTGCATGG - Intronic
1010003248 6:70969280-70969302 GTGGCTGCCTGGACCCTGAAGGG + Intergenic
1014451994 6:121592486-121592508 GTTCCTTTCTAGACCCTGCAGGG - Intergenic
1015555760 6:134459782-134459804 GTGGCCTCCAAGACCCTAAAAGG + Intergenic
1015980266 6:138831367-138831389 ATGGCATCCAAGGCCCTGCAGGG + Intronic
1018317965 6:162576037-162576059 GTGGTCTCCTAAACCTTACAGGG - Intronic
1018565480 6:165146895-165146917 ATGCCCTCCATGACCCTGCATGG + Intergenic
1026382438 7:69813055-69813077 ATGGCCTACAAGACACTGCACGG + Intronic
1029188058 7:98753517-98753539 GTAGCCATCTAGCCCCTGCAGGG - Intergenic
1029607318 7:101606716-101606738 TGGGCCTCCAAGACACTGCAGGG - Intergenic
1030729665 7:112971648-112971670 GTGGCCTACAAGGCTCTGCATGG - Intergenic
1034834232 7:154336944-154336966 GTGGCAGCCGAGACCCGGCAGGG + Intronic
1034946927 7:155268344-155268366 GGAGCCTCCTGGGCCCTGCAAGG + Intergenic
1035051516 7:156001548-156001570 GTGGCCTCCCAGCCCCTCCATGG + Intergenic
1036433038 8:8707333-8707355 GTTTCTTCCTAGACCCTGCGTGG + Intergenic
1036755397 8:11467712-11467734 GTGGGGTCTTAGCCCCTGCAGGG + Intronic
1036768323 8:11562944-11562966 GTGGCCTCCCAAAGCTTGCATGG + Intronic
1041729772 8:61052021-61052043 GTTGCCTCCTGGTCCCTGCCTGG + Intergenic
1047927210 8:129693466-129693488 ATGGCCCCCTAGACCCTTGACGG + Intergenic
1048399184 8:134047913-134047935 GTGACTTCCTAGAGGCTGCAGGG + Intergenic
1048568825 8:135632746-135632768 GTGGCCTGCATGACCCTGCATGG + Intronic
1048968694 8:139631905-139631927 GTTCCCTCTCAGACCCTGCAAGG - Intronic
1049210815 8:141385706-141385728 GGGACCTCTTAGACCCTGGAGGG - Intergenic
1049410221 8:142470704-142470726 TTGGGCTCCTGGATCCTGCAGGG + Intronic
1049658403 8:143808934-143808956 GAGGCCCCCTGGACCCTGCCAGG - Exonic
1049844532 8:144793436-144793458 GGTGTTTCCTAGACCCTGCAGGG + Intergenic
1053051921 9:34969130-34969152 GTGGCCTGTGAGGCCCTGCATGG - Intronic
1053165506 9:35841309-35841331 GTGGCCTCATACAGGCTGCAGGG + Intronic
1058644204 9:107115648-107115670 ATGGCCTCCAAGACCCCACATGG + Intergenic
1060190848 9:121591517-121591539 GTGGCCTCCAAGATCCTGGGTGG - Intronic
1061245791 9:129400815-129400837 GTGGCCACCCGGACCTTGCAGGG + Intergenic
1061504945 9:131026524-131026546 GTGGCCTTCTCCACCCTGGAGGG + Exonic
1062413159 9:136434747-136434769 GTGGCCACCTGGAACATGCAGGG - Exonic
1062427229 9:136511608-136511630 GTGGGCTCCACGACACTGCAGGG + Intronic
1188228580 X:27632431-27632453 ATGGCCTGCAAGACCCTACATGG + Intronic
1195586073 X:106566785-106566807 GTAGCCCCCAAGACCCTGCTGGG + Intergenic
1196622515 X:117839694-117839716 GTGAGCTCCTAGACTCTCCAGGG - Intergenic