ID: 1077925951

View in Genome Browser
Species Human (GRCh38)
Location 11:6682340-6682362
Sequence CTCGGTACAAAGATCAAACT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077925951_1077925957 2 Left 1077925951 11:6682340-6682362 CCCAGTTTGATCTTTGTACCGAG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1077925957 11:6682365-6682387 GCCAGTACTTGAAACAGCTTTGG 0: 1
1: 0
2: 0
3: 10
4: 116
1077925951_1077925961 25 Left 1077925951 11:6682340-6682362 CCCAGTTTGATCTTTGTACCGAG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1077925961 11:6682388-6682410 GATCAAATCCTTCTCCTAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 130
1077925951_1077925959 3 Left 1077925951 11:6682340-6682362 CCCAGTTTGATCTTTGTACCGAG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1077925959 11:6682366-6682388 CCAGTACTTGAAACAGCTTTGGG 0: 1
1: 0
2: 1
3: 12
4: 161
1077925951_1077925960 24 Left 1077925951 11:6682340-6682362 CCCAGTTTGATCTTTGTACCGAG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1077925960 11:6682387-6682409 GGATCAAATCCTTCTCCTAGAGG 0: 1
1: 0
2: 0
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077925951 Original CRISPR CTCGGTACAAAGATCAAACT GGG (reversed) Exonic
914437357 1:147671558-147671580 CTATCTCCAAAGATCAAACTGGG + Intergenic
915254600 1:154616787-154616809 CTGGGTACACAGATCTATCTGGG - Intronic
917810455 1:178653257-178653279 CTTGGTACAAAGGCCAAGCTGGG + Intergenic
921856286 1:219988758-219988780 CTCAGTATAAAGAAAAAACTGGG - Exonic
923251157 1:232180633-232180655 CTTGGTACAAAGAGCAAAAGAGG - Intergenic
923469937 1:234281450-234281472 ATGGGTACAAAGAGCAAACAAGG - Intronic
1070662078 10:78314151-78314173 CTGGTTACAGAAATCAAACTGGG + Intergenic
1074935880 10:118181113-118181135 CTTGGTACATACATTAAACTGGG - Intergenic
1075582142 10:123627994-123628016 CCATGTACAAAGATGAAACTTGG - Intergenic
1077925951 11:6682340-6682362 CTCGGTACAAAGATCAAACTGGG - Exonic
1083143790 11:60742638-60742660 CTAAGAACAAAGATCAAACAAGG - Intronic
1085617545 11:78012826-78012848 CTAGGTACAAAGTTCAATGTGGG + Intergenic
1086423020 11:86656445-86656467 ATAGGGACATAGATCAAACTGGG + Intronic
1086451395 11:86920510-86920532 CTGGGGACAAACATCATACTAGG + Intronic
1094152010 12:27295208-27295230 CACAATACAAAGATTAAACTAGG + Intronic
1098512279 12:71330683-71330705 GTGGGAACAAAGATCCAACTGGG - Intronic
1111346569 13:86964148-86964170 CTCGGAACAAATATCAAACATGG + Intergenic
1115328302 14:32166674-32166696 AGCGGTAGTAAGATCAAACTTGG - Intergenic
1115917273 14:38329944-38329966 CCCTGTACCAAGAACAAACTGGG - Intergenic
1117976949 14:61308455-61308477 CTGAGTACTAAGATGAAACTTGG - Intronic
1141143694 16:81514374-81514396 CTCGTTCCTAAGGTCAAACTGGG - Intronic
1151790590 17:76303257-76303279 CTGGGTACAAAAAACAACCTGGG - Intronic
1151910470 17:77079567-77079589 TTCTGTACAAAGATCCAGCTGGG - Intergenic
1154134815 18:11767076-11767098 CTGGGCAGAAATATCAAACTGGG - Intronic
1160119380 18:76114212-76114234 CTAGTTTCAAAAATCAAACTGGG - Intergenic
1162060328 19:8090850-8090872 CCAGGAAGAAAGATCAAACTTGG + Intronic
1166979949 19:46626344-46626366 CTTGTTACAAAGACCAATCTGGG - Intergenic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
929463196 2:42120658-42120680 CTCAATACAAATATCAAATTGGG + Intergenic
932308335 2:70719624-70719646 TTCAGTAAAAAGGTCAAACTTGG + Intronic
938362922 2:130706321-130706343 CTGGGTAAAAAAATTAAACTTGG - Intergenic
938736382 2:134190311-134190333 CTTGCTACAAAAATCAAACATGG - Intronic
938902950 2:135813831-135813853 CTCGGAAGAAAAACCAAACTAGG + Intronic
943085418 2:183305161-183305183 CTCGTTACATAGAAAAAACTTGG + Intergenic
943148084 2:184071515-184071537 CTCAATATAAAGATCAAGCTTGG - Intergenic
945855772 2:215068113-215068135 GTTGGTCCAAGGATCAAACTTGG - Intronic
1170506240 20:17028589-17028611 CTTGGCACAGAGATCAAAATCGG - Intergenic
1172822142 20:37746270-37746292 CTCATTACAAAAATCAATCTTGG - Intronic
1183878255 22:40802951-40802973 CACTGTATAATGATCAAACTGGG + Intronic
952232467 3:31446158-31446180 CTAGGGACAAAGAACAATCTTGG + Intergenic
962302508 3:134254583-134254605 CTCAGAACATACATCAAACTGGG - Intergenic
971419098 4:26459517-26459539 CTCATTACAAAGATCATAATTGG - Intergenic
973040758 4:45467281-45467303 GTTGTTACAAAGGTCAAACTTGG - Intergenic
976413666 4:84746625-84746647 CTCAGTAAGAACATCAAACTAGG - Intronic
979155658 4:117386278-117386300 ATGGGTACAAAGATGAAAGTAGG + Intergenic
983776435 4:171613269-171613291 CTAGGTCCAAACATCAAACCAGG + Intergenic
984088459 4:175341030-175341052 GTCCTTACAAAGATCAAATTAGG + Intergenic
992973409 5:82085762-82085784 CTAGGTACAAAGTTTAAACAAGG + Intronic
1010752453 6:79631025-79631047 CTCGGTTCAAAGTCCAAGCTTGG - Intergenic
1013208706 6:107967715-107967737 CTTGGTAGAAATATGAAACTTGG - Intergenic
1016103819 6:140137196-140137218 CTTGCTACAAATATAAAACTGGG - Intergenic
1021009698 7:15446768-15446790 CTCTTTACAAAGAACAAACGAGG - Intronic
1021502960 7:21350134-21350156 CAGAGTACAATGATCAAACTAGG - Intergenic
1023002700 7:35827906-35827928 CTCTGTACAAAGATAAAACATGG - Intronic
1030863468 7:114667992-114668014 CTAGGGACAAAGATGAAAATTGG + Intronic
1045648887 8:104324886-104324908 CTCTGTACACAGAACAGACTTGG + Intergenic
1050579211 9:7033215-7033237 CTTTGTATAAAGATCAAAGTCGG - Intronic
1052684329 9:31735193-31735215 CTTAGTACAAAGATCTAACAAGG + Intergenic
1056988071 9:91383492-91383514 CTAGGTACACAGATTAAACCCGG - Intergenic
1058957902 9:109966165-109966187 GTCGGCAGAAAGATCAATCTGGG + Intronic
1188920744 X:35973664-35973686 CTCTGTACTGAGACCAAACTGGG + Intronic
1190469006 X:50757429-50757451 GTCTTTAAAAAGATCAAACTTGG - Intronic
1200883342 Y:8243479-8243501 CTCTGTAGAAAGGTGAAACTGGG + Intergenic