ID: 1077929979

View in Genome Browser
Species Human (GRCh38)
Location 11:6720965-6720987
Sequence CTGATCAATGGGAAAGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077929974_1077929979 5 Left 1077929974 11:6720937-6720959 CCTGGACAGCAGGCTTGGATAAC 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1077929979 11:6720965-6720987 CTGATCAATGGGAAAGTGGCAGG 0: 1
1: 0
2: 2
3: 19
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077929979 Original CRISPR CTGATCAATGGGAAAGTGGC AGG Intergenic
900241297 1:1618742-1618764 ATGAACAATGGGAATGGGGCAGG + Intronic
901034796 1:6329923-6329945 CTGCTCACTGGGAAAGCTGCAGG + Intronic
901978290 1:13012645-13012667 CTCATCAAGGGGAACGTGGCAGG + Intronic
902003794 1:13216293-13216315 CTCATCAAGGGGAACGTGGCAGG - Intergenic
902023019 1:13362037-13362059 CTCATCAAGGGGAACGTGGCAGG - Intergenic
903931582 1:26865204-26865226 CTGGCCAATGGGAAAGTGAGCGG + Intergenic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905037472 1:34927522-34927544 CAGATCAGTGGGGCAGTGGCGGG + Intronic
905778232 1:40684788-40684810 CTGATCAATGGGAGACAGGAAGG - Intergenic
908934824 1:69362656-69362678 CTGTCGAATGGGAAAGTGGGAGG - Intergenic
911110736 1:94181820-94181842 CTGAGCACTGGAAATGTGGCTGG + Intronic
911208947 1:95119515-95119537 TTGAGAAATGGGAAAGGGGCTGG + Intronic
911812769 1:102304644-102304666 CTACTCAATGTGAAAGTGACAGG + Intergenic
912506146 1:110157750-110157772 CTGAACAATGGAAGAGTGGGAGG - Intronic
912582715 1:110734877-110734899 CTTAACAAAGGGCAAGTGGCTGG + Intergenic
912642604 1:111361615-111361637 CTCAGCAAGGGGAATGTGGCAGG + Intergenic
915463928 1:156084954-156084976 CTGCTGAATGGGGAAGGGGCTGG + Intronic
915893564 1:159793513-159793535 CTGTCCAATGGTCAAGTGGCTGG - Intergenic
917029355 1:170671920-170671942 CTGAGAAATGGAGAAGTGGCTGG + Intronic
924260808 1:242228806-242228828 ATGATGAATGAGAAAATGGCGGG + Intronic
1065886830 10:30085716-30085738 CTGCTCAGTTGCAAAGTGGCTGG - Intronic
1067730313 10:48805782-48805804 CTGATCAATTAGATAGTGACAGG - Intronic
1071087934 10:81885275-81885297 CTGATCAATGGAAAAGTGTCAGG + Intronic
1071403637 10:85305175-85305197 CTGATCATTGAAAAAGTAGCTGG + Intergenic
1073468129 10:103706282-103706304 CTGCTCAGTGGGTCAGTGGCTGG + Intronic
1076633745 10:131869234-131869256 CTGAGCACTGGCAATGTGGCTGG - Intergenic
1077250548 11:1558841-1558863 GTGGTCAATGGGAAAGGGGCAGG - Intronic
1077498475 11:2898089-2898111 CTGAGAAATGGGACTGTGGCTGG - Intronic
1077929979 11:6720965-6720987 CTGATCAATGGGAAAGTGGCAGG + Intergenic
1081666400 11:44919398-44919420 GTGATCAATGGGAGAGTGCCTGG - Intronic
1082969598 11:59005503-59005525 CTCAGCAAGGGGAATGTGGCAGG - Intronic
1083330639 11:61896867-61896889 TTGCTCAGTGGGACAGTGGCAGG - Intergenic
1084493925 11:69492918-69492940 CTGAAAAAAGAGAAAGTGGCTGG + Intergenic
1084914998 11:72421969-72421991 CTGAACACTAGGAAACTGGCCGG + Intronic
1087842524 11:102935052-102935074 CTGAGCACTGGAAATGTGGCTGG + Intergenic
1089063129 11:115642536-115642558 CTGGTCATAGGGAAAGTGGTAGG - Intergenic
1089528932 11:119114072-119114094 CTGAGCAATGGGCACCTGGCAGG - Exonic
1091070109 11:132555028-132555050 GAGATCCATGGGAAAATGGCGGG + Intronic
1091770165 12:3146217-3146239 GTGGTCAATGGCAAAGGGGCAGG + Intronic
1091836269 12:3588348-3588370 CTGACCAATGGCTAAGTGGCTGG - Intronic
1092881245 12:12889405-12889427 TTGAGCAATGGAAATGTGGCTGG + Intergenic
1094676727 12:32627863-32627885 ATGGTTAATGAGAAAGTGGCGGG + Intronic
1098031539 12:66259770-66259792 CTGGTCAAGGGGAAAGTGGTAGG - Intergenic
1102034944 12:109765737-109765759 CTGATCAGTGGGGAGGTAGCAGG + Intronic
1102597986 12:114007483-114007505 CTCATCAATGGGAATGTTGATGG - Intergenic
1106418038 13:29562129-29562151 GTGATCATTGGGAAACTGGCAGG - Intronic
1107649125 13:42526524-42526546 CAGATCAAAGAGAAAGAGGCAGG + Intergenic
1107918844 13:45182391-45182413 AAGAACATTGGGAAAGTGGCCGG - Intronic
1108085155 13:46781159-46781181 CTGATTAATGTTATAGTGGCAGG - Intronic
1108935466 13:55876024-55876046 CTTTTCCATGGGAAACTGGCTGG + Intergenic
1110163714 13:72411120-72411142 CTGACCCATTAGAAAGTGGCAGG - Intergenic
1111892052 13:94095583-94095605 CTGATCACTTGAAATGTGGCTGG - Intronic
1112471587 13:99694481-99694503 CTGATGGATGGGTAAGTGCCAGG - Intronic
1119900306 14:78253921-78253943 AGGACCAATGAGAAAGTGGCTGG - Intronic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1123753793 15:23380628-23380650 CTGCTCAGATGGAAAGTGGCTGG - Intergenic
1123966870 15:25468129-25468151 CTGATCAGTGGTGAGGTGGCTGG + Intergenic
1125639978 15:41222410-41222432 GTTAACAATGGGAAAGCGGCTGG - Intronic
1125885944 15:43229585-43229607 CTGGTCAGTGGGCAAGTGGTGGG + Intergenic
1127202509 15:56671395-56671417 ATGGTCATTGGGAAACTGGCTGG - Intronic
1127626587 15:60786246-60786268 TTGATCAATGGGGAAATGGAGGG - Intronic
1128609057 15:69059332-69059354 TTAATCAAAGGGAAAGGGGCTGG + Intronic
1131741362 15:95396407-95396429 CTGAACAATGGGGCAGTGGTAGG + Intergenic
1131798769 15:96047894-96047916 CTGAACAATGGGAAAGTTTGAGG - Intergenic
1132031392 15:98441020-98441042 CTGATCACTAGGAAAGTGAGAGG + Intronic
1133144682 16:3775874-3775896 TTGAGCCTTGGGAAAGTGGCTGG - Intronic
1133315060 16:4877704-4877726 GTGATCACAGGGAAAGTTGCGGG + Intronic
1135054988 16:19224357-19224379 CAGATGAATGGGAAAATGGATGG + Intronic
1135136200 16:19886410-19886432 CTGCGCAATTGGAAAGTGGATGG + Intergenic
1137016806 16:35385030-35385052 CTGGTCAGTGGGACAGTGGATGG + Intergenic
1137386643 16:48048345-48048367 TTCCTCAGTGGGAAAGTGGCAGG - Intergenic
1137904640 16:52308566-52308588 CTTATAAATGGGATGGTGGCAGG - Intergenic
1138329537 16:56202514-56202536 CTGATGAATGGAAAAGTTGAAGG + Intronic
1138621553 16:58215383-58215405 GTCACCAATGGGAAAGTGGTGGG + Intergenic
1139873585 16:70127307-70127329 CTGCTCAATGGTCAAGTGCCTGG - Exonic
1140362193 16:74353841-74353863 CTGCTCAATGGTCAAGTGCCTGG + Intergenic
1140888450 16:79264778-79264800 CAGATCCATGGGAAACTGGTGGG - Intergenic
1141674265 16:85509360-85509382 CAGAACAATGGGGGAGTGGCTGG + Intergenic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1143337196 17:6180289-6180311 CTAATTCATGGGAATGTGGCTGG + Intergenic
1143556968 17:7668023-7668045 CTGCTCCATCAGAAAGTGGCAGG - Intronic
1148222156 17:45870661-45870683 CTGAACAAGGGGCAAGAGGCCGG - Intergenic
1151696862 17:75722274-75722296 CTGAGCCATGGGAAAGAGGGCGG - Intronic
1155516327 18:26626864-26626886 CTGTGCAATGGGAAATTGCCTGG + Intronic
1164779721 19:30882666-30882688 CTGATAAATGGCTGAGTGGCAGG - Intergenic
1164837762 19:31368977-31368999 CTGAACACTGGGAATGAGGCTGG - Intergenic
1165455691 19:35909359-35909381 CTGCTGAATGAGGAAGTGGCTGG + Intergenic
1165521327 19:36316607-36316629 CTGAACACTGGGAAAGTGAGGGG + Intergenic
1165622734 19:37261981-37262003 CTGAACACTGGGAAAGTGAGGGG - Intergenic
1165634433 19:37328616-37328638 CTGAACACTGGGAAAGTGAGGGG - Intronic
925103430 2:1268978-1269000 CTCATCTATGGGAAGGTGACAGG + Intronic
925158464 2:1664436-1664458 TTCTTCAATGGGAAAGTCGCTGG - Intronic
927735188 2:25514356-25514378 TAGAGCAATGGGAAAGTGGCAGG + Intronic
930094417 2:47556115-47556137 CAGAGAAATGGGAAAGTAGCAGG + Intronic
932339366 2:70951377-70951399 CTGATAAATTGGAATGTGGATGG - Intronic
933807892 2:86013208-86013230 CTGTTCTAGGGGACAGTGGCAGG + Intergenic
934477210 2:94601745-94601767 CTGATCAATGGGAGAATGGAAGG + Intronic
934989284 2:98910175-98910197 CTTCTCAATGGGGAAGTGGGAGG - Intronic
935225444 2:101048196-101048218 CTTAAAAATGGGAAAGTTGCAGG - Intronic
936060360 2:109291569-109291591 CAGATCACAGGGACAGTGGCAGG - Intronic
938568231 2:132539686-132539708 CTGATCCATGGGAACTTAGCTGG + Intronic
946047960 2:216836955-216836977 CTTCTCAAAGGGAAAATGGCTGG + Intergenic
948658043 2:239488987-239489009 CAGATGAATGGGAGAGTGGGTGG - Intergenic
1170271931 20:14537108-14537130 TTGATCACTGGGATAGTGGTTGG + Intronic
1172337354 20:34128311-34128333 CTCAGCAAGGGGAATGTGGCGGG - Intergenic
1172615566 20:36281302-36281324 CAGATGAATGGGAGAGTGGATGG - Intergenic
1173140110 20:40474541-40474563 CAGTTAAATGGCAAAGTGGCCGG + Intergenic
1175162137 20:57016676-57016698 CTGAACACTGGAAATGTGGCTGG - Intergenic
1177625470 21:23654418-23654440 CTGAGCATTTGGAAAGTAGCTGG - Intergenic
1179297737 21:40078606-40078628 ATGTTCGATGGGAAAGGGGCAGG + Intronic
1179802218 21:43816455-43816477 CTGGTCAGGGGGAGAGTGGCAGG - Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1181530355 22:23513820-23513842 CTGAACAATGGCAGTGTGGCCGG + Intergenic
1185119668 22:48958502-48958524 CTGGACAATGGGACAGTGGGAGG - Intergenic
949969681 3:9394505-9394527 TTGAGCATTGGAAAAGTGGCTGG - Intergenic
953251676 3:41249750-41249772 CTGACCAAGGGGAAAGAGGCAGG + Intronic
954584588 3:51722257-51722279 CTCAACAATGGGAAGGAGGCAGG + Intergenic
955021497 3:55126119-55126141 CTGAGCACTGGGAATGTGCCTGG - Intergenic
955666749 3:61357010-61357032 CTGATACATTGGAAAGGGGCTGG + Intergenic
958761641 3:98316333-98316355 CTCAGCAAGGGGAAAGTGGCAGG + Intergenic
960377257 3:116918462-116918484 ATGATAAATTGGAAAGTGGCAGG - Intronic
963837413 3:150071054-150071076 CTGGACAAGGGGAGAGTGGCAGG + Intergenic
967328928 3:188270944-188270966 TTAATCAATGGCAAAGTAGCAGG + Intronic
968396324 4:241975-241997 CTCAGCAAGGGGAATGTGGCAGG - Intergenic
972640614 4:40921863-40921885 CTGACCATTGGTAATGTGGCTGG + Intronic
972927005 4:44021732-44021754 CTGGTAAAAGGGAAAGTTGCAGG - Intergenic
973930746 4:55790921-55790943 CTGCTCACTGGGAAAGGGGATGG - Intergenic
976271165 4:83231659-83231681 CTTATCAATGGGGAAATGGTGGG - Intergenic
976986250 4:91302690-91302712 CAGAGAAAAGGGAAAGTGGCTGG - Intronic
977103394 4:92847308-92847330 CTGAGCCATGGGAAAATGCCAGG - Intronic
982472801 4:155814082-155814104 CTGAGCACTTGAAAAGTGGCTGG - Intergenic
993881641 5:93369747-93369769 ATGATCTGTGGAAAAGTGGCAGG - Intergenic
994065530 5:95536015-95536037 CTGACCAAAAGGAAAGAGGCTGG + Intronic
994951394 5:106468027-106468049 CTGAACACTGGCAAAGTGGCTGG - Intergenic
997318910 5:132962324-132962346 CTGGTCAATGGAAAAGTGACTGG + Intronic
1000367575 5:160505598-160505620 CTCATGGCTGGGAAAGTGGCAGG - Intergenic
1000923998 5:167171648-167171670 CTACTCAATAGGAATGTGGCTGG + Intergenic
1001235630 5:170026973-170026995 CATATGAATGGGAAAGTGTCAGG + Intronic
1001599578 5:172920207-172920229 TTCCTCAAAGGGAAAGTGGCTGG - Intronic
1003294435 6:4811893-4811915 CTGATGAATGGGGAAGAGGGTGG - Intronic
1008717527 6:54307143-54307165 CAGATCCATGGGGGAGTGGCTGG + Intergenic
1009052142 6:58289077-58289099 GTGAACACTGGGAAAGTAGCAGG + Intergenic
1009799842 6:68522896-68522918 CTGATTGATGGGAATTTGGCTGG + Intergenic
1011384228 6:86777057-86777079 CTGATCAATGTGAATGAGACTGG - Intergenic
1012420348 6:99057813-99057835 CTGATCATGGGAAAAGTGGATGG + Intergenic
1012713095 6:102632953-102632975 CTCTTGAATGGGAAAGTGGGAGG + Intergenic
1014769043 6:125440448-125440470 TTGATCAATTGGGAAGTTGCTGG - Intergenic
1015286847 6:131495267-131495289 GTGATCCAAGGGAAAGTGGATGG - Intergenic
1019205997 6:170362443-170362465 CAGAACACTGGGAGAGTGGCAGG - Intronic
1019909427 7:4090197-4090219 CTGATTAATTGTAAAGTGGGTGG - Intronic
1022166232 7:27765530-27765552 CTTTACAATGGGAAAGAGGCTGG - Intronic
1022952641 7:35353169-35353191 TTGACCAATAGGAAAGTGGATGG + Intergenic
1023960473 7:44922096-44922118 CTGAAGCATGGAAAAGTGGCCGG + Intergenic
1025215440 7:57052154-57052176 CTGTTCAAGGGGTGAGTGGCGGG - Intergenic
1025626187 7:63224581-63224603 CTGTTCAAGGGGTGAGTGGCGGG - Intergenic
1025655935 7:63518548-63518570 CTGTTCAAGGGGTGAGTGGCGGG + Intergenic
1026311188 7:69186085-69186107 CTGAGGCAGGGGAAAGTGGCAGG - Intergenic
1026338058 7:69411705-69411727 CTGAGCAATGTGACAGTGACAGG + Intergenic
1028493338 7:91438449-91438471 GTGATCAATGGAGAAGGGGCAGG + Intergenic
1028763978 7:94529644-94529666 CTGAGTAATAGGAATGTGGCTGG + Intronic
1030322142 7:108180264-108180286 GTGGTCAATGGGAAAGGGGAGGG - Exonic
1030561539 7:111093022-111093044 CACATTTATGGGAAAGTGGCAGG - Intronic
1038164022 8:25067532-25067554 CTGATCACTGCGGAATTGGCAGG - Intergenic
1039149062 8:34482905-34482927 CTGAAGAATGGGATGGTGGCAGG + Intergenic
1039589065 8:38731248-38731270 AGGTTCAATGGGAAAGTGCCAGG + Intronic
1040480245 8:47819043-47819065 CTGAGCAGTGGGGAAGAGGCAGG - Intronic
1041093429 8:54326086-54326108 CAAAGCAATGGGAAAGTGCCTGG + Intergenic
1042565996 8:70112668-70112690 CTTAGCAATTGGTAAGTGGCTGG + Exonic
1042848546 8:73192382-73192404 CTGAAAAATGGGAAAATGGCTGG + Intergenic
1042883687 8:73523754-73523776 CTGATGAACTGGAAAGTGGGAGG + Intronic
1045266331 8:100621759-100621781 CTGACCAATGGCAAAGAGTCGGG - Intronic
1046683590 8:117199202-117199224 CTGATACATGGGAATGTGGCTGG - Intergenic
1046904790 8:119560737-119560759 CTGATAAATTGGAAAGAGGATGG + Intronic
1047006048 8:120621451-120621473 GTGAGAAATGGGAAAGTGGAGGG + Intronic
1049793578 8:144484967-144484989 GAGATCACTGGGAAAGAGGCCGG + Intronic
1049922184 9:375532-375554 CTGATTAATGGGGAAATTGCTGG + Intronic
1050396671 9:5205170-5205192 GTGATCAAGAGGAAAGTGGAGGG - Intergenic
1052840645 9:33289173-33289195 CTGGTCACTTGGCAAGTGGCTGG + Intergenic
1052889584 9:33685930-33685952 CTGAGCACTGGGAAAGGGGTGGG + Intergenic
1057506450 9:95637485-95637507 CTGAGCACTGGGAATGTGGCTGG + Intergenic
1058786833 9:108396335-108396357 GAGGTCAGTGGGAAAGTGGCTGG + Intergenic
1059725182 9:117001529-117001551 CAGAGCACTGGGAGAGTGGCAGG - Intronic
1060286469 9:122257837-122257859 CTGTTGAATGGGGAAGTGGTAGG + Intronic
1060606056 9:124915057-124915079 GTGATCATTAGGAAAGGGGCAGG - Intronic
1060892597 9:127198278-127198300 CTGAGCACTGGGAAAGGGGGAGG - Intronic
1061674041 9:132205582-132205604 CTTAACAATGGTAAGGTGGCTGG + Intronic
1186987774 X:15035716-15035738 GGGATCATTGGGAAAATGGCAGG - Intergenic
1191018443 X:55835411-55835433 CTCAGCAAGGGGAATGTGGCAGG + Intergenic
1193189159 X:78548964-78548986 CTGAACAATAGGAAAGTGGCAGG + Intergenic
1193496514 X:82219791-82219813 CTGCTTAATGGAAAAGTGGCTGG - Intergenic
1195353803 X:104019323-104019345 CTAATCAAAGGGAAAATAGCTGG - Intergenic
1199061392 X:143359249-143359271 CTGAAAAATGGGAAACAGGCTGG + Intergenic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic