ID: 1077930250

View in Genome Browser
Species Human (GRCh38)
Location 11:6723904-6723926
Sequence TTCCCAGGACCACACAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077930244_1077930250 16 Left 1077930244 11:6723865-6723887 CCATCAATAACCCAGAGCTCAAG No data
Right 1077930250 11:6723904-6723926 TTCCCAGGACCACACAGAAGTGG No data
1077930247_1077930250 5 Left 1077930247 11:6723876-6723898 CCAGAGCTCAAGTATGAGGATGA No data
Right 1077930250 11:6723904-6723926 TTCCCAGGACCACACAGAAGTGG No data
1077930246_1077930250 6 Left 1077930246 11:6723875-6723897 CCCAGAGCTCAAGTATGAGGATG No data
Right 1077930250 11:6723904-6723926 TTCCCAGGACCACACAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077930250 Original CRISPR TTCCCAGGACCACACAGAAG TGG Intergenic
No off target data available for this crispr