ID: 1077930297

View in Genome Browser
Species Human (GRCh38)
Location 11:6724274-6724296
Sequence GTTTAGCAGCAGCACATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077930296_1077930297 -7 Left 1077930296 11:6724258-6724280 CCAAATCAGAGTGGCTGTTTAGC 0: 5
1: 31
2: 79
3: 69
4: 123
Right 1077930297 11:6724274-6724296 GTTTAGCAGCAGCACATTGTAGG No data
1077930294_1077930297 5 Left 1077930294 11:6724246-6724268 CCAAAGGAGATGCCAAATCAGAG 0: 25
1: 40
2: 53
3: 80
4: 220
Right 1077930297 11:6724274-6724296 GTTTAGCAGCAGCACATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077930297 Original CRISPR GTTTAGCAGCAGCACATTGT AGG Intergenic
No off target data available for this crispr