ID: 1077937702

View in Genome Browser
Species Human (GRCh38)
Location 11:6806482-6806504
Sequence GATTTAGCTCCCAATTTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077937699_1077937702 4 Left 1077937699 11:6806455-6806477 CCCATGTTTATGTTCATGTGAGC No data
Right 1077937702 11:6806482-6806504 GATTTAGCTCCCAATTTTAAGGG No data
1077937696_1077937702 22 Left 1077937696 11:6806437-6806459 CCCACAGGGTTTATTGTCCCCAT No data
Right 1077937702 11:6806482-6806504 GATTTAGCTCCCAATTTTAAGGG No data
1077937700_1077937702 3 Left 1077937700 11:6806456-6806478 CCATGTTTATGTTCATGTGAGCT No data
Right 1077937702 11:6806482-6806504 GATTTAGCTCCCAATTTTAAGGG No data
1077937697_1077937702 21 Left 1077937697 11:6806438-6806460 CCACAGGGTTTATTGTCCCCATG No data
Right 1077937702 11:6806482-6806504 GATTTAGCTCCCAATTTTAAGGG No data
1077937698_1077937702 5 Left 1077937698 11:6806454-6806476 CCCCATGTTTATGTTCATGTGAG No data
Right 1077937702 11:6806482-6806504 GATTTAGCTCCCAATTTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077937702 Original CRISPR GATTTAGCTCCCAATTTTAA GGG Intergenic
No off target data available for this crispr