ID: 1077938516

View in Genome Browser
Species Human (GRCh38)
Location 11:6815293-6815315
Sequence GTCACTGCTCATAGATGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077938514_1077938516 -4 Left 1077938514 11:6815274-6815296 CCTAGTGGGAGGTGTTTAGGTCA 0: 18
1: 334
2: 1290
3: 2781
4: 5996
Right 1077938516 11:6815293-6815315 GTCACTGCTCATAGATGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077938516 Original CRISPR GTCACTGCTCATAGATGGCA TGG Intergenic
No off target data available for this crispr