ID: 1077940278

View in Genome Browser
Species Human (GRCh38)
Location 11:6833573-6833595
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077940274_1077940278 22 Left 1077940274 11:6833528-6833550 CCACTAACACACAAGGCAGCAGT No data
Right 1077940278 11:6833573-6833595 TTATTAGCTCAGCTGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077940278 Original CRISPR TTATTAGCTCAGCTGGAACA AGG Intergenic
No off target data available for this crispr