ID: 1077945009 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:6887683-6887705 |
| Sequence | AAATACCTAATGTAGATGAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1077945009_1077945020 | 30 | Left | 1077945009 | 11:6887683-6887705 | CCAGTCATCTACATTAGGTATTT | No data | ||
| Right | 1077945020 | 11:6887736-6887758 | ATCCCCCGACAGGCCCCGGTGGG | No data | ||||
| 1077945009_1077945017 | 26 | Left | 1077945009 | 11:6887683-6887705 | CCAGTCATCTACATTAGGTATTT | No data | ||
| Right | 1077945017 | 11:6887732-6887754 | CTCCATCCCCCGACAGGCCCCGG | No data | ||||
| 1077945009_1077945019 | 29 | Left | 1077945009 | 11:6887683-6887705 | CCAGTCATCTACATTAGGTATTT | No data | ||
| Right | 1077945019 | 11:6887735-6887757 | CATCCCCCGACAGGCCCCGGTGG | No data | ||||
| 1077945009_1077945015 | 20 | Left | 1077945009 | 11:6887683-6887705 | CCAGTCATCTACATTAGGTATTT | No data | ||
| Right | 1077945015 | 11:6887726-6887748 | CTAGACCTCCATCCCCCGACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1077945009 | Original CRISPR | AAATACCTAATGTAGATGAC TGG (reversed) | Intergenic | ||