ID: 1077945010

View in Genome Browser
Species Human (GRCh38)
Location 11:6887708-6887730
Sequence TCTAGGGGAAGGATAGCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077945010_1077945017 1 Left 1077945010 11:6887708-6887730 CCTAATGCTATCCTTCCCCTAGA No data
Right 1077945017 11:6887732-6887754 CTCCATCCCCCGACAGGCCCCGG No data
1077945010_1077945019 4 Left 1077945010 11:6887708-6887730 CCTAATGCTATCCTTCCCCTAGA No data
Right 1077945019 11:6887735-6887757 CATCCCCCGACAGGCCCCGGTGG No data
1077945010_1077945015 -5 Left 1077945010 11:6887708-6887730 CCTAATGCTATCCTTCCCCTAGA No data
Right 1077945015 11:6887726-6887748 CTAGACCTCCATCCCCCGACAGG No data
1077945010_1077945020 5 Left 1077945010 11:6887708-6887730 CCTAATGCTATCCTTCCCCTAGA No data
Right 1077945020 11:6887736-6887758 ATCCCCCGACAGGCCCCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077945010 Original CRISPR TCTAGGGGAAGGATAGCATT AGG (reversed) Intergenic