ID: 1077945011

View in Genome Browser
Species Human (GRCh38)
Location 11:6887719-6887741
Sequence GGGGATGGAGGTCTAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077945011_1077945019 -7 Left 1077945011 11:6887719-6887741 CCTTCCCCTAGACCTCCATCCCC No data
Right 1077945019 11:6887735-6887757 CATCCCCCGACAGGCCCCGGTGG No data
1077945011_1077945020 -6 Left 1077945011 11:6887719-6887741 CCTTCCCCTAGACCTCCATCCCC No data
Right 1077945020 11:6887736-6887758 ATCCCCCGACAGGCCCCGGTGGG No data
1077945011_1077945017 -10 Left 1077945011 11:6887719-6887741 CCTTCCCCTAGACCTCCATCCCC No data
Right 1077945017 11:6887732-6887754 CTCCATCCCCCGACAGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077945011 Original CRISPR GGGGATGGAGGTCTAGGGGA AGG (reversed) Intergenic