ID: 1077945012

View in Genome Browser
Species Human (GRCh38)
Location 11:6887723-6887745
Sequence GTCGGGGGATGGAGGTCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077945012_1077945020 -10 Left 1077945012 11:6887723-6887745 CCCCTAGACCTCCATCCCCCGAC No data
Right 1077945020 11:6887736-6887758 ATCCCCCGACAGGCCCCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077945012 Original CRISPR GTCGGGGGATGGAGGTCTAG GGG (reversed) Intergenic