ID: 1077945015

View in Genome Browser
Species Human (GRCh38)
Location 11:6887726-6887748
Sequence CTAGACCTCCATCCCCCGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077945009_1077945015 20 Left 1077945009 11:6887683-6887705 CCAGTCATCTACATTAGGTATTT No data
Right 1077945015 11:6887726-6887748 CTAGACCTCCATCCCCCGACAGG No data
1077945010_1077945015 -5 Left 1077945010 11:6887708-6887730 CCTAATGCTATCCTTCCCCTAGA No data
Right 1077945015 11:6887726-6887748 CTAGACCTCCATCCCCCGACAGG No data
1077945007_1077945015 27 Left 1077945007 11:6887676-6887698 CCATCAACCAGTCATCTACATTA No data
Right 1077945015 11:6887726-6887748 CTAGACCTCCATCCCCCGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077945015 Original CRISPR CTAGACCTCCATCCCCCGAC AGG Intergenic