ID: 1077945019 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:6887735-6887757 |
| Sequence | CATCCCCCGACAGGCCCCGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1077945011_1077945019 | -7 | Left | 1077945011 | 11:6887719-6887741 | CCTTCCCCTAGACCTCCATCCCC | No data | ||
| Right | 1077945019 | 11:6887735-6887757 | CATCCCCCGACAGGCCCCGGTGG | No data | ||||
| 1077945009_1077945019 | 29 | Left | 1077945009 | 11:6887683-6887705 | CCAGTCATCTACATTAGGTATTT | No data | ||
| Right | 1077945019 | 11:6887735-6887757 | CATCCCCCGACAGGCCCCGGTGG | No data | ||||
| 1077945010_1077945019 | 4 | Left | 1077945010 | 11:6887708-6887730 | CCTAATGCTATCCTTCCCCTAGA | No data | ||
| Right | 1077945019 | 11:6887735-6887757 | CATCCCCCGACAGGCCCCGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1077945019 | Original CRISPR | CATCCCCCGACAGGCCCCGG TGG | Intergenic | ||