ID: 1077945020

View in Genome Browser
Species Human (GRCh38)
Location 11:6887736-6887758
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077945011_1077945020 -6 Left 1077945011 11:6887719-6887741 CCTTCCCCTAGACCTCCATCCCC No data
Right 1077945020 11:6887736-6887758 ATCCCCCGACAGGCCCCGGTGGG No data
1077945010_1077945020 5 Left 1077945010 11:6887708-6887730 CCTAATGCTATCCTTCCCCTAGA No data
Right 1077945020 11:6887736-6887758 ATCCCCCGACAGGCCCCGGTGGG No data
1077945009_1077945020 30 Left 1077945009 11:6887683-6887705 CCAGTCATCTACATTAGGTATTT No data
Right 1077945020 11:6887736-6887758 ATCCCCCGACAGGCCCCGGTGGG No data
1077945012_1077945020 -10 Left 1077945012 11:6887723-6887745 CCCCTAGACCTCCATCCCCCGAC No data
Right 1077945020 11:6887736-6887758 ATCCCCCGACAGGCCCCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077945020 Original CRISPR ATCCCCCGACAGGCCCCGGT GGG Intergenic